Incidental Mutation 'R9757:Ccdc191'
ID 732815
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43941807 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 20 (T20I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: T20I

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132859
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178400
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,465,239 V105A probably benign Het
Agrn C A 4: 156,176,778 V621L probably benign Het
Anapc1 A G 2: 128,675,756 S323P probably damaging Het
Anxa6 T A 11: 54,994,356 K456* probably null Het
C7 G T 15: 5,045,652 T186K probably damaging Het
Cacna1b T C 2: 24,719,101 E396G probably damaging Het
Ces1b G T 8: 93,079,873 P15Q probably benign Het
Dnah14 G T 1: 181,685,784 A1901S probably benign Het
Dock3 T C 9: 107,023,836 H310R possibly damaging Het
Eif2ak4 T G 2: 118,438,917 S23R probably benign Het
Gli2 A G 1: 118,845,922 C485R probably damaging Het
Gm13078 A G 4: 143,728,422 D430G probably benign Het
Gm17093 T A 14: 44,521,533 W171R Het
Ing2 G A 8: 47,675,040 probably benign Het
Itpkb T C 1: 180,332,807 I166T probably benign Het
Kcnj8 T A 6: 142,570,079 I101F probably benign Het
Krtap6-2 C T 16: 89,420,070 C3Y unknown Het
Lep A G 6: 29,069,084 I45V probably benign Het
Lrrk2 A T 15: 91,811,026 I2355L probably benign Het
Mettl3 C A 14: 52,299,904 A174S probably benign Het
Mmp23 T C 4: 155,651,058 N317S probably damaging Het
Mybpc1 A T 10: 88,536,395 V777E probably damaging Het
Nlrp9b T A 7: 20,048,692 C844S probably damaging Het
Obscn T C 11: 59,001,512 E6823G probably benign Het
Olfr220 A T 1: 174,449,300 I226F probably damaging Het
Pcdhb1 A T 18: 37,267,249 Q751L probably benign Het
Pdgfrl T A 8: 40,926,417 L16Q possibly damaging Het
Pdzph1 A C 17: 58,974,903 L128* probably null Het
Prr36 A T 8: 4,210,998 S940T probably damaging Het
Rad54l2 A T 9: 106,717,921 I279N probably damaging Het
Rasgrp3 A T 17: 75,500,724 T259S probably damaging Het
Rrn3 T A 16: 13,810,569 I538N probably damaging Het
Sdf2l1 A T 16: 17,130,534 D213E probably benign Het
Sorcs3 T C 19: 48,722,924 Y643H probably damaging Het
Sval2 G T 6: 41,861,840 C4F possibly damaging Het
Taldo1 A G 7: 141,400,350 E131G probably benign Het
Tas2r130 T C 6: 131,630,333 I166M probably benign Het
Tmem178 A G 17: 81,000,860 Y228C probably damaging Het
Ttn A T 2: 76,782,079 L17188* probably null Het
Unc45b A G 11: 82,919,732 K273E probably damaging Het
Usp32 A C 11: 85,077,329 Y169* probably null Het
Vmn2r9 A T 5: 108,848,042 Y247N possibly damaging Het
Zkscan2 A T 7: 123,480,087 C882* probably null Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R7843:Ccdc191 UTSW 16 43959336 missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43889899 start gained probably benign
R8984:Ccdc191 UTSW 16 43890218 intron probably benign
R8987:Ccdc191 UTSW 16 43931347 missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43898149 missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43905468 missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43943678 nonsense probably null
R9448:Ccdc191 UTSW 16 43938975 missense
R9507:Ccdc191 UTSW 16 43943829 missense probably damaging 0.99
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGGACTAAAATAGACCTTGTAGC -3'
(R):5'- CAGGGTAGATGCTTTAGCCTC -3'

Sequencing Primer
(F):5'- GACCTTGTAGCTCACAAAATAAACTC -3'
(R):5'- GGTAGATGCTTTAGCCTCTTTTAAAC -3'
Posted On 2022-11-14