Incidental Mutation 'R9757:Pdzph1'
ID 732817
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 59281898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 128 (L128*)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably null
Transcript: ENSMUST00000025064
AA Change: L128*
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: L128*

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,613,086 (GRCm39) V105A probably benign Het
Agrn C A 4: 156,261,235 (GRCm39) V621L probably benign Het
Anapc1 A G 2: 128,517,676 (GRCm39) S323P probably damaging Het
Anxa6 T A 11: 54,885,182 (GRCm39) K456* probably null Het
C7 G T 15: 5,075,134 (GRCm39) T186K probably damaging Het
Cacna1b T C 2: 24,609,113 (GRCm39) E396G probably damaging Het
Ccdc191 C T 16: 43,762,170 (GRCm39) T20I Het
Ces1b G T 8: 93,806,501 (GRCm39) P15Q probably benign Het
Dnah14 G T 1: 181,513,349 (GRCm39) A1901S probably benign Het
Dock3 T C 9: 106,901,035 (GRCm39) H310R possibly damaging Het
Eif2ak4 T G 2: 118,269,398 (GRCm39) S23R probably benign Het
Gli2 A G 1: 118,773,652 (GRCm39) C485R probably damaging Het
Gm17093 T A 14: 44,758,990 (GRCm39) W171R Het
Ing2 G A 8: 48,128,075 (GRCm39) probably benign Het
Itpkb T C 1: 180,160,372 (GRCm39) I166T probably benign Het
Kcnj8 T A 6: 142,515,805 (GRCm39) I101F probably benign Het
Krtap6-2 C T 16: 89,216,958 (GRCm39) C3Y unknown Het
Lep A G 6: 29,069,083 (GRCm39) I45V probably benign Het
Lrrk2 A T 15: 91,695,229 (GRCm39) I2355L probably benign Het
Mettl3 C A 14: 52,537,361 (GRCm39) A174S probably benign Het
Mmp23 T C 4: 155,735,515 (GRCm39) N317S probably damaging Het
Mybpc1 A T 10: 88,372,257 (GRCm39) V777E probably damaging Het
Nlrp9b T A 7: 19,782,617 (GRCm39) C844S probably damaging Het
Obscn T C 11: 58,892,338 (GRCm39) E6823G probably benign Het
Or6y1 A T 1: 174,276,866 (GRCm39) I226F probably damaging Het
Pcdhb1 A T 18: 37,400,302 (GRCm39) Q751L probably benign Het
Pdgfrl T A 8: 41,379,454 (GRCm39) L16Q possibly damaging Het
Pramel24 A G 4: 143,454,992 (GRCm39) D430G probably benign Het
Prr36 A T 8: 4,260,998 (GRCm39) S940T probably damaging Het
Rad54l2 A T 9: 106,595,120 (GRCm39) I279N probably damaging Het
Rasgrp3 A T 17: 75,807,719 (GRCm39) T259S probably damaging Het
Rrn3 T A 16: 13,628,433 (GRCm39) I538N probably damaging Het
Sdf2l1 A T 16: 16,948,398 (GRCm39) D213E probably benign Het
Sorcs3 T C 19: 48,711,363 (GRCm39) Y643H probably damaging Het
Sval2 G T 6: 41,838,774 (GRCm39) C4F possibly damaging Het
Taldo1 A G 7: 140,980,263 (GRCm39) E131G probably benign Het
Tas2r130 T C 6: 131,607,296 (GRCm39) I166M probably benign Het
Tmem178 A G 17: 81,308,289 (GRCm39) Y228C probably damaging Het
Ttn A T 2: 76,612,423 (GRCm39) L17188* probably null Het
Unc45b A G 11: 82,810,558 (GRCm39) K273E probably damaging Het
Usp32 A C 11: 84,968,155 (GRCm39) Y169* probably null Het
Vmn2r9 A T 5: 108,995,908 (GRCm39) Y247N possibly damaging Het
Zkscan2 A T 7: 123,079,310 (GRCm39) C882* probably null Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTCCATACTTGCTGG -3'
(R):5'- AGACTGTGTTTCATCAGACTAGG -3'

Sequencing Primer
(F):5'- CTCCATACTTGCTGGACAGAATAATG -3'
(R):5'- GTTTCATCAGACTAGGACATTAGGG -3'
Posted On 2022-11-14