Incidental Mutation 'R9757:Pdzph1'
ID 732817
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 58878808-58991375 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 58974903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 128 (L128*)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably null
Transcript: ENSMUST00000025064
AA Change: L128*
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: L128*

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,465,239 V105A probably benign Het
Agrn C A 4: 156,176,778 V621L probably benign Het
Anapc1 A G 2: 128,675,756 S323P probably damaging Het
Anxa6 T A 11: 54,994,356 K456* probably null Het
C7 G T 15: 5,045,652 T186K probably damaging Het
Cacna1b T C 2: 24,719,101 E396G probably damaging Het
Ccdc191 C T 16: 43,941,807 T20I Het
Ces1b G T 8: 93,079,873 P15Q probably benign Het
Dnah14 G T 1: 181,685,784 A1901S probably benign Het
Dock3 T C 9: 107,023,836 H310R possibly damaging Het
Eif2ak4 T G 2: 118,438,917 S23R probably benign Het
Gli2 A G 1: 118,845,922 C485R probably damaging Het
Gm13078 A G 4: 143,728,422 D430G probably benign Het
Gm17093 T A 14: 44,521,533 W171R Het
Ing2 G A 8: 47,675,040 probably benign Het
Itpkb T C 1: 180,332,807 I166T probably benign Het
Kcnj8 T A 6: 142,570,079 I101F probably benign Het
Krtap6-2 C T 16: 89,420,070 C3Y unknown Het
Lep A G 6: 29,069,084 I45V probably benign Het
Lrrk2 A T 15: 91,811,026 I2355L probably benign Het
Mettl3 C A 14: 52,299,904 A174S probably benign Het
Mmp23 T C 4: 155,651,058 N317S probably damaging Het
Mybpc1 A T 10: 88,536,395 V777E probably damaging Het
Nlrp9b T A 7: 20,048,692 C844S probably damaging Het
Obscn T C 11: 59,001,512 E6823G probably benign Het
Olfr220 A T 1: 174,449,300 I226F probably damaging Het
Pcdhb1 A T 18: 37,267,249 Q751L probably benign Het
Pdgfrl T A 8: 40,926,417 L16Q possibly damaging Het
Prr36 A T 8: 4,210,998 S940T probably damaging Het
Rad54l2 A T 9: 106,717,921 I279N probably damaging Het
Rasgrp3 A T 17: 75,500,724 T259S probably damaging Het
Rrn3 T A 16: 13,810,569 I538N probably damaging Het
Sdf2l1 A T 16: 17,130,534 D213E probably benign Het
Sorcs3 T C 19: 48,722,924 Y643H probably damaging Het
Sval2 G T 6: 41,861,840 C4F possibly damaging Het
Taldo1 A G 7: 141,400,350 E131G probably benign Het
Tas2r130 T C 6: 131,630,333 I166M probably benign Het
Tmem178 A G 17: 81,000,860 Y228C probably damaging Het
Ttn A T 2: 76,782,079 L17188* probably null Het
Unc45b A G 11: 82,919,732 K273E probably damaging Het
Usp32 A C 11: 85,077,329 Y169* probably null Het
Vmn2r9 A T 5: 108,848,042 Y247N possibly damaging Het
Zkscan2 A T 7: 123,480,087 C882* probably null Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 58967341 missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 58879110 missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 58932481 missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 58975143 missense probably benign 0.01
R8273:Pdzph1 UTSW 17 58973014 missense probably benign 0.00
R8523:Pdzph1 UTSW 17 58884013 missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 58880720 nonsense probably null
R8820:Pdzph1 UTSW 17 58880720 nonsense probably null
R8839:Pdzph1 UTSW 17 58950242 missense probably benign 0.02
R8871:Pdzph1 UTSW 17 58888038 missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 58974339 missense probably benign 0.00
R8959:Pdzph1 UTSW 17 58974604 missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 58973540 missense probably benign 0.05
R9083:Pdzph1 UTSW 17 58954400 missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 58973130 missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 58950267 missense probably damaging 1.00
R9774:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTCCATACTTGCTGG -3'
(R):5'- AGACTGTGTTTCATCAGACTAGG -3'

Sequencing Primer
(F):5'- CTCCATACTTGCTGGACAGAATAATG -3'
(R):5'- GTTTCATCAGACTAGGACATTAGGG -3'
Posted On 2022-11-14