Incidental Mutation 'R9757:Tmem178'
ID 732819
Institutional Source Beutler Lab
Gene Symbol Tmem178
Ensembl Gene ENSMUSG00000024245
Gene Name transmembrane protein 178
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80944632-81001816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81000860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 228 (Y228C)
Ref Sequence ENSEMBL: ENSMUSP00000025092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025092]
AlphaFold Q9CZ16
Predicted Effect probably damaging
Transcript: ENSMUST00000025092
AA Change: Y228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025092
Gene: ENSMUSG00000024245
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:Claudin_2 16 277 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone mass, osteopenia, and increased osteoclast differentiation under basal and inflammatory conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,465,239 V105A probably benign Het
Agrn C A 4: 156,176,778 V621L probably benign Het
Anapc1 A G 2: 128,675,756 S323P probably damaging Het
Anxa6 T A 11: 54,994,356 K456* probably null Het
C7 G T 15: 5,045,652 T186K probably damaging Het
Cacna1b T C 2: 24,719,101 E396G probably damaging Het
Ccdc191 C T 16: 43,941,807 T20I Het
Ces1b G T 8: 93,079,873 P15Q probably benign Het
Dnah14 G T 1: 181,685,784 A1901S probably benign Het
Dock3 T C 9: 107,023,836 H310R possibly damaging Het
Eif2ak4 T G 2: 118,438,917 S23R probably benign Het
Gli2 A G 1: 118,845,922 C485R probably damaging Het
Gm13078 A G 4: 143,728,422 D430G probably benign Het
Gm17093 T A 14: 44,521,533 W171R Het
Ing2 G A 8: 47,675,040 probably benign Het
Itpkb T C 1: 180,332,807 I166T probably benign Het
Kcnj8 T A 6: 142,570,079 I101F probably benign Het
Krtap6-2 C T 16: 89,420,070 C3Y unknown Het
Lep A G 6: 29,069,084 I45V probably benign Het
Lrrk2 A T 15: 91,811,026 I2355L probably benign Het
Mettl3 C A 14: 52,299,904 A174S probably benign Het
Mmp23 T C 4: 155,651,058 N317S probably damaging Het
Mybpc1 A T 10: 88,536,395 V777E probably damaging Het
Nlrp9b T A 7: 20,048,692 C844S probably damaging Het
Obscn T C 11: 59,001,512 E6823G probably benign Het
Olfr220 A T 1: 174,449,300 I226F probably damaging Het
Pcdhb1 A T 18: 37,267,249 Q751L probably benign Het
Pdgfrl T A 8: 40,926,417 L16Q possibly damaging Het
Pdzph1 A C 17: 58,974,903 L128* probably null Het
Prr36 A T 8: 4,210,998 S940T probably damaging Het
Rad54l2 A T 9: 106,717,921 I279N probably damaging Het
Rasgrp3 A T 17: 75,500,724 T259S probably damaging Het
Rrn3 T A 16: 13,810,569 I538N probably damaging Het
Sdf2l1 A T 16: 17,130,534 D213E probably benign Het
Sorcs3 T C 19: 48,722,924 Y643H probably damaging Het
Sval2 G T 6: 41,861,840 C4F possibly damaging Het
Taldo1 A G 7: 141,400,350 E131G probably benign Het
Tas2r130 T C 6: 131,630,333 I166M probably benign Het
Ttn A T 2: 76,782,079 L17188* probably null Het
Unc45b A G 11: 82,919,732 K273E probably damaging Het
Usp32 A C 11: 85,077,329 Y169* probably null Het
Vmn2r9 A T 5: 108,848,042 Y247N possibly damaging Het
Zkscan2 A T 7: 123,480,087 C882* probably null Het
Other mutations in Tmem178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02249:Tmem178 APN 17 80989806 missense probably damaging 0.99
R0603:Tmem178 UTSW 17 80945059 missense possibly damaging 0.68
R1155:Tmem178 UTSW 17 81001000 missense possibly damaging 0.46
R4169:Tmem178 UTSW 17 80944803 missense possibly damaging 0.85
R4503:Tmem178 UTSW 17 80986264 missense probably benign 0.03
R4863:Tmem178 UTSW 17 80944945 missense probably benign 0.00
R5919:Tmem178 UTSW 17 80989758 missense probably damaging 0.99
R7442:Tmem178 UTSW 17 80944756 missense probably damaging 1.00
R7464:Tmem178 UTSW 17 80944902 missense probably benign
R7986:Tmem178 UTSW 17 81000844 missense possibly damaging 0.90
X0003:Tmem178 UTSW 17 80986188 missense probably benign 0.16
Z1177:Tmem178 UTSW 17 80945074 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAATTGAAACATGCCTGG -3'
(R):5'- TTCGTCCGGCTAATAAACGG -3'

Sequencing Primer
(F):5'- GAATTTTCACTGGTCTTAGTCACAGC -3'
(R):5'- TTCGTCCGGCTAATAAACGGATAAG -3'
Posted On 2022-11-14