Mutagenetix > Incidental Mutation

Incidental Mutation 'R9757:Pcdhb1'

732820

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb1

Ensembl Gene

ENSMUSG00000051663

Gene Name

protocadherin beta 1

Synonyms

PcdhbA

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R9757 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37264938-37267525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37267249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 751 (Q751L)

Ref Sequence

ENSEMBL: ENSMUSP00000057519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]

AlphaFold

Q91Y08

Predicted Effect

probably benign
Transcript: ENSMUST00000052366
AA Change: Q751L

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: Q751L

Domain	Start	End	E-Value	Type
CA	45	131	1.04e-1	SMART
CA	155	240	1.23e-19	SMART
CA	264	345	8.4e-27	SMART
CA	369	450	5.31e-15	SMART
CA	474	560	6.27e-26	SMART
CA	590	671	6.05e-10	SMART
Pfam:Cadherin_C_2	687	772	4.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,465,239	V105A	probably benign	Het
Agrn	C	A	4: 156,176,778	V621L	probably benign	Het
Anapc1	A	G	2: 128,675,756	S323P	probably damaging	Het
Anxa6	T	A	11: 54,994,356	K456*	probably null	Het
C7	G	T	15: 5,045,652	T186K	probably damaging	Het
Cacna1b	T	C	2: 24,719,101	E396G	probably damaging	Het
Ccdc191	C	T	16: 43,941,807	T20I		Het
Ces1b	G	T	8: 93,079,873	P15Q	probably benign	Het
Dnah14	G	T	1: 181,685,784	A1901S	probably benign	Het
Dock3	T	C	9: 107,023,836	H310R	possibly damaging	Het
Eif2ak4	T	G	2: 118,438,917	S23R	probably benign	Het
Gli2	A	G	1: 118,845,922	C485R	probably damaging	Het
Gm13078	A	G	4: 143,728,422	D430G	probably benign	Het
Gm17093	T	A	14: 44,521,533	W171R		Het
Ing2	G	A	8: 47,675,040		probably benign	Het
Itpkb	T	C	1: 180,332,807	I166T	probably benign	Het
Kcnj8	T	A	6: 142,570,079	I101F	probably benign	Het
Krtap6-2	C	T	16: 89,420,070	C3Y	unknown	Het
Lep	A	G	6: 29,069,084	I45V	probably benign	Het
Lrrk2	A	T	15: 91,811,026	I2355L	probably benign	Het
Mettl3	C	A	14: 52,299,904	A174S	probably benign	Het
Mmp23	T	C	4: 155,651,058	N317S	probably damaging	Het
Mybpc1	A	T	10: 88,536,395	V777E	probably damaging	Het
Nlrp9b	T	A	7: 20,048,692	C844S	probably damaging	Het
Obscn	T	C	11: 59,001,512	E6823G	probably benign	Het
Olfr220	A	T	1: 174,449,300	I226F	probably damaging	Het
Pdgfrl	T	A	8: 40,926,417	L16Q	possibly damaging	Het
Pdzph1	A	C	17: 58,974,903	L128*	probably null	Het
Prr36	A	T	8: 4,210,998	S940T	probably damaging	Het
Rad54l2	A	T	9: 106,717,921	I279N	probably damaging	Het
Rasgrp3	A	T	17: 75,500,724	T259S	probably damaging	Het
Rrn3	T	A	16: 13,810,569	I538N	probably damaging	Het
Sdf2l1	A	T	16: 17,130,534	D213E	probably benign	Het
Sorcs3	T	C	19: 48,722,924	Y643H	probably damaging	Het
Sval2	G	T	6: 41,861,840	C4F	possibly damaging	Het
Taldo1	A	G	7: 141,400,350	E131G	probably benign	Het
Tas2r130	T	C	6: 131,630,333	I166M	probably benign	Het
Tmem178	A	G	17: 81,000,860	Y228C	probably damaging	Het
Ttn	A	T	2: 76,782,079	L17188*	probably null	Het
Unc45b	A	G	11: 82,919,732	K273E	probably damaging	Het
Usp32	A	C	11: 85,077,329	Y169*	probably null	Het
Vmn2r9	A	T	5: 108,848,042	Y247N	possibly damaging	Het
Zkscan2	A	T	7: 123,480,087	C882*	probably null	Het

Other mutations in Pcdhb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Pcdhb1	APN	18	37267342	missense	probably benign	0.06
IGL01622:Pcdhb1	APN	18	37266313	missense	possibly damaging	0.73
IGL01623:Pcdhb1	APN	18	37266313	missense	possibly damaging	0.73
IGL01663:Pcdhb1	APN	18	37267133	missense	possibly damaging	0.83
IGL01665:Pcdhb1	APN	18	37267397	missense	probably benign	0.01
IGL01780:Pcdhb1	APN	18	37266522	missense	probably damaging	1.00
IGL02121:Pcdhb1	APN	18	37265785	missense	probably benign	0.06
IGL02468:Pcdhb1	APN	18	37266178	missense	probably benign	0.21
IGL02602:Pcdhb1	APN	18	37266796	missense	probably damaging	1.00
K3955:Pcdhb1	UTSW	18	37265973	missense	probably damaging	1.00
R0242:Pcdhb1	UTSW	18	37266735	missense	probably benign	0.17
R0242:Pcdhb1	UTSW	18	37266735	missense	probably benign	0.17
R0329:Pcdhb1	UTSW	18	37267024	missense	possibly damaging	0.59
R0627:Pcdhb1	UTSW	18	37265721	missense	probably damaging	1.00
R0848:Pcdhb1	UTSW	18	37267422	missense	probably benign	0.00
R1187:Pcdhb1	UTSW	18	37265544	missense	probably damaging	1.00
R1290:Pcdhb1	UTSW	18	37265230	missense	possibly damaging	0.54
R1928:Pcdhb1	UTSW	18	37266180	nonsense	probably null
R1957:Pcdhb1	UTSW	18	37265707	missense	probably damaging	1.00
R2897:Pcdhb1	UTSW	18	37266463	missense	probably damaging	1.00
R2898:Pcdhb1	UTSW	18	37266463	missense	probably damaging	1.00
R3037:Pcdhb1	UTSW	18	37265113	missense	probably damaging	1.00
R4193:Pcdhb1	UTSW	18	37267146	missense	probably damaging	0.99
R4291:Pcdhb1	UTSW	18	37265417	missense	probably damaging	1.00
R4308:Pcdhb1	UTSW	18	37266661	missense	probably benign	0.00
R4332:Pcdhb1	UTSW	18	37265530	missense	probably damaging	1.00
R4606:Pcdhb1	UTSW	18	37265528	nonsense	probably null
R4637:Pcdhb1	UTSW	18	37265749	missense	possibly damaging	0.95
R5159:Pcdhb1	UTSW	18	37266363	missense	possibly damaging	0.89
R5207:Pcdhb1	UTSW	18	37266462	missense	probably damaging	1.00
R5211:Pcdhb1	UTSW	18	37266651	missense	probably benign	0.06
R5273:Pcdhb1	UTSW	18	37265713	missense	probably benign	0.23
R5335:Pcdhb1	UTSW	18	37267255	missense	probably benign	0.00
R5398:Pcdhb1	UTSW	18	37266154	missense	probably damaging	1.00
R5452:Pcdhb1	UTSW	18	37265758	missense	possibly damaging	0.94
R5837:Pcdhb1	UTSW	18	37265827	missense	possibly damaging	0.57
R5882:Pcdhb1	UTSW	18	37267177	missense	probably benign	0.05
R5947:Pcdhb1	UTSW	18	37266673	missense	possibly damaging	0.74
R6109:Pcdhb1	UTSW	18	37265253	missense	possibly damaging	0.69
R7052:Pcdhb1	UTSW	18	37266529	missense	probably damaging	1.00
R7082:Pcdhb1	UTSW	18	37266991	missense	probably damaging	0.99
R7137:Pcdhb1	UTSW	18	37267392	missense	possibly damaging	0.69
R7229:Pcdhb1	UTSW	18	37266687	missense	probably damaging	1.00
R7392:Pcdhb1	UTSW	18	37265118	missense	possibly damaging	0.95
R7993:Pcdhb1	UTSW	18	37266991	missense	probably damaging	1.00
R8704:Pcdhb1	UTSW	18	37266349	missense	possibly damaging	0.51
R9498:Pcdhb1	UTSW	18	37265463	missense	probably damaging	0.99
R9703:Pcdhb1	UTSW	18	37265966	missense	probably damaging	1.00
T0970:Pcdhb1	UTSW	18	37265973	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGCAGTTCCAGGATCCATC -3'
(R):5'- ATCTCCTATCCGGTCATGGC -3'

Sequencing Primer
(F):5'- GGATCCATCCAAGCATTCTAGAAAGG -3'
(R):5'- TCATGGCCCGCTGAACC -3'

Posted On

2022-11-14