Incidental Mutation 'R9759:Mier1'
ID 732896
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103019725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 483 (T483I)
Ref Sequence ENSEMBL: ENSMUSP00000095558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect probably benign
Transcript: ENSMUST00000030247
AA Change: T455I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: T455I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097945
AA Change: T483I

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: T483I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
AA Change: T257I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522
AA Change: T257I

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106857
AA Change: T438I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: T438I

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106858
AA Change: T455I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: T455I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,615,989 (GRCm39) W508L probably damaging Het
Abt1 G T 13: 23,606,439 (GRCm39) Q172K probably damaging Het
Aoah C A 13: 21,000,738 (GRCm39) H57Q probably damaging Het
Cpxm2 T C 7: 131,756,242 (GRCm39) E34G probably benign Het
Ddx25 C T 9: 35,457,265 (GRCm39) R350Q probably benign Het
Dnah9 G A 11: 65,965,944 (GRCm39) H1691Y probably null Het
Doc2g A T 19: 4,056,571 (GRCm39) H319L probably benign Het
Enah A C 1: 181,841,911 (GRCm39) V6G unknown Het
Fam135b T G 15: 71,335,689 (GRCm39) T502P probably benign Het
Frem2 A G 3: 53,562,918 (GRCm39) S530P possibly damaging Het
Gm19410 A G 8: 36,252,938 (GRCm39) R628G possibly damaging Het
Hdac7 T C 15: 97,699,989 (GRCm39) T614A probably benign Het
Ift88 T A 14: 57,672,256 (GRCm39) L32* probably null Het
Insm2 C T 12: 55,647,390 (GRCm39) T378M possibly damaging Het
Kctd3 G A 1: 188,710,786 (GRCm39) T459M probably damaging Het
Khsrp A G 17: 57,332,925 (GRCm39) L188P probably benign Het
Kynu A G 2: 43,569,881 (GRCm39) I388V probably benign Het
Met T C 6: 17,555,561 (GRCm39) V1090A probably damaging Het
Mthfsd A G 8: 121,824,615 (GRCm39) S297P probably benign Het
P2rx5 A T 11: 73,058,341 (GRCm39) I259F probably damaging Het
Pax3 A G 1: 78,170,415 (GRCm39) L138P probably damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Rbm12 A T 2: 155,938,546 (GRCm39) H575Q probably benign Het
Scube1 C T 15: 83,492,465 (GRCm39) R953H probably benign Het
Sirt1 A G 10: 63,156,516 (GRCm39) S705P probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc46a3 T C 5: 147,823,234 (GRCm39) T203A probably benign Het
Snta1 G T 2: 154,222,889 (GRCm39) T278K probably benign Het
Stac3 A G 10: 127,344,083 (GRCm39) D327G possibly damaging Het
Timm44 C A 8: 4,317,707 (GRCm39) E205* probably null Het
Timm8a2 A T 14: 122,272,216 (GRCm39) T40S probably damaging Het
Vmn2r116 A G 17: 23,620,360 (GRCm39) N698S possibly damaging Het
Zik1 A C 7: 10,223,716 (GRCm39) C460W possibly damaging Het
Zmynd8 A C 2: 165,680,746 (GRCm39) I229S possibly damaging Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R2997:Mier1 UTSW 4 102,988,233 (GRCm39) missense probably damaging 1.00
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4728:Mier1 UTSW 4 102,997,402 (GRCm39) missense probably damaging 1.00
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R4798:Mier1 UTSW 4 102,988,195 (GRCm39) missense probably damaging 1.00
R5075:Mier1 UTSW 4 102,996,670 (GRCm39) missense probably benign 0.02
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7304:Mier1 UTSW 4 102,996,599 (GRCm39) nonsense probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACTCAGATTGGTGCTTTCC -3'
(R):5'- CCATGTGAGACTGCTTCCTG -3'

Sequencing Primer
(F):5'- TTGTAGCAGATATTTCAGAAGAGTTG -3'
(R):5'- GTGAGACTGCTTCCTGGAAAAACTC -3'
Posted On 2022-11-14