Incidental Mutation 'R9759:Cpxm2'
ID 732900
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Name carboxypeptidase X, M14 family member 2
Synonyms 4632435C11Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 131634416-131756468 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131756242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 34 (E34G)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033149
AA Change: E34G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: E34G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,615,989 (GRCm39) W508L probably damaging Het
Abt1 G T 13: 23,606,439 (GRCm39) Q172K probably damaging Het
Aoah C A 13: 21,000,738 (GRCm39) H57Q probably damaging Het
Ddx25 C T 9: 35,457,265 (GRCm39) R350Q probably benign Het
Dnah9 G A 11: 65,965,944 (GRCm39) H1691Y probably null Het
Doc2g A T 19: 4,056,571 (GRCm39) H319L probably benign Het
Enah A C 1: 181,841,911 (GRCm39) V6G unknown Het
Fam135b T G 15: 71,335,689 (GRCm39) T502P probably benign Het
Frem2 A G 3: 53,562,918 (GRCm39) S530P possibly damaging Het
Gm19410 A G 8: 36,252,938 (GRCm39) R628G possibly damaging Het
Hdac7 T C 15: 97,699,989 (GRCm39) T614A probably benign Het
Ift88 T A 14: 57,672,256 (GRCm39) L32* probably null Het
Insm2 C T 12: 55,647,390 (GRCm39) T378M possibly damaging Het
Kctd3 G A 1: 188,710,786 (GRCm39) T459M probably damaging Het
Khsrp A G 17: 57,332,925 (GRCm39) L188P probably benign Het
Kynu A G 2: 43,569,881 (GRCm39) I388V probably benign Het
Met T C 6: 17,555,561 (GRCm39) V1090A probably damaging Het
Mier1 C T 4: 103,019,725 (GRCm39) T483I probably benign Het
Mthfsd A G 8: 121,824,615 (GRCm39) S297P probably benign Het
P2rx5 A T 11: 73,058,341 (GRCm39) I259F probably damaging Het
Pax3 A G 1: 78,170,415 (GRCm39) L138P probably damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Rbm12 A T 2: 155,938,546 (GRCm39) H575Q probably benign Het
Scube1 C T 15: 83,492,465 (GRCm39) R953H probably benign Het
Sirt1 A G 10: 63,156,516 (GRCm39) S705P probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc46a3 T C 5: 147,823,234 (GRCm39) T203A probably benign Het
Snta1 G T 2: 154,222,889 (GRCm39) T278K probably benign Het
Stac3 A G 10: 127,344,083 (GRCm39) D327G possibly damaging Het
Timm44 C A 8: 4,317,707 (GRCm39) E205* probably null Het
Timm8a2 A T 14: 122,272,216 (GRCm39) T40S probably damaging Het
Vmn2r116 A G 17: 23,620,360 (GRCm39) N698S possibly damaging Het
Zik1 A C 7: 10,223,716 (GRCm39) C460W possibly damaging Het
Zmynd8 A C 2: 165,680,746 (GRCm39) I229S possibly damaging Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 131,661,540 (GRCm39) missense probably benign 0.01
IGL02039:Cpxm2 APN 7 131,649,482 (GRCm39) missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 131,650,807 (GRCm39) missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 131,663,886 (GRCm39) missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 131,656,600 (GRCm39) missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 131,656,600 (GRCm39) missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 131,730,134 (GRCm39) missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 131,645,772 (GRCm39) nonsense probably null
R0655:Cpxm2 UTSW 7 131,656,549 (GRCm39) missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 131,756,342 (GRCm39) intron probably benign
R1145:Cpxm2 UTSW 7 131,659,377 (GRCm39) missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 131,659,377 (GRCm39) missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 131,730,079 (GRCm39) critical splice donor site probably null
R1563:Cpxm2 UTSW 7 131,745,411 (GRCm39) missense probably benign 0.00
R1565:Cpxm2 UTSW 7 131,663,874 (GRCm39) missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 131,661,563 (GRCm39) missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 131,745,392 (GRCm39) splice site probably null
R1874:Cpxm2 UTSW 7 131,661,563 (GRCm39) missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 131,663,876 (GRCm39) missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 131,661,581 (GRCm39) intron probably benign
R3806:Cpxm2 UTSW 7 131,681,820 (GRCm39) missense probably benign 0.12
R3861:Cpxm2 UTSW 7 131,656,648 (GRCm39) missense probably benign 0.00
R4570:Cpxm2 UTSW 7 131,745,435 (GRCm39) missense probably benign 0.11
R4642:Cpxm2 UTSW 7 131,672,610 (GRCm39) missense probably benign 0.11
R4684:Cpxm2 UTSW 7 131,650,767 (GRCm39) missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 131,656,574 (GRCm39) missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 131,661,476 (GRCm39) missense probably benign 0.13
R5079:Cpxm2 UTSW 7 131,756,014 (GRCm39) critical splice donor site probably null
R5341:Cpxm2 UTSW 7 131,756,342 (GRCm39) intron probably benign
R5626:Cpxm2 UTSW 7 131,661,581 (GRCm39) intron probably benign
R5666:Cpxm2 UTSW 7 131,656,625 (GRCm39) missense probably benign 0.44
R5815:Cpxm2 UTSW 7 131,645,839 (GRCm39) missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 131,756,035 (GRCm39) missense probably benign
R6133:Cpxm2 UTSW 7 131,730,182 (GRCm39) missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 131,745,460 (GRCm39) missense probably benign
R6468:Cpxm2 UTSW 7 131,672,589 (GRCm39) missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 131,650,806 (GRCm39) missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 131,745,408 (GRCm39) missense probably benign 0.32
R7100:Cpxm2 UTSW 7 131,656,544 (GRCm39) missense probably benign 0.06
R7198:Cpxm2 UTSW 7 131,681,813 (GRCm39) missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 131,756,107 (GRCm39) missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 131,659,424 (GRCm39) missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 131,650,800 (GRCm39) missense probably damaging 1.00
R8513:Cpxm2 UTSW 7 131,745,431 (GRCm39) missense probably benign 0.01
R8694:Cpxm2 UTSW 7 131,681,783 (GRCm39) missense probably benign 0.03
R8874:Cpxm2 UTSW 7 131,708,010 (GRCm39) critical splice donor site probably null
R8967:Cpxm2 UTSW 7 131,661,564 (GRCm39) missense probably damaging 1.00
R9680:Cpxm2 UTSW 7 131,661,651 (GRCm39) missense probably damaging 1.00
RF014:Cpxm2 UTSW 7 131,672,592 (GRCm39) missense possibly damaging 0.85
Z1177:Cpxm2 UTSW 7 131,656,730 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAAAAGTTACCTGGTGGAG -3'
(R):5'- AGTCGTCATTTGTAGCCCGC -3'

Sequencing Primer
(F):5'- TGGAGGCGTCTCTGCAACTAAC -3'
(R):5'- ATTTGTAGCCCGCCTGCC -3'
Posted On 2022-11-14