Incidental Mutation 'R9759:Mthfsd'
ID 732903
Institutional Source Beutler Lab
Gene Symbol Mthfsd
Ensembl Gene ENSMUSG00000031816
Gene Name methenyltetrahydrofolate synthetase domain containing
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R9759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 121818367-121835131 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121824615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 297 (S297P)
Ref Sequence ENSEMBL: ENSMUSP00000115382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047282] [ENSMUST00000116415] [ENSMUST00000126431] [ENSMUST00000127664] [ENSMUST00000128052] [ENSMUST00000133037] [ENSMUST00000139782] [ENSMUST00000134758]
AlphaFold Q3URQ7
Predicted Effect probably benign
Transcript: ENSMUST00000047282
SMART Domains Protein: ENSMUSP00000044172
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 1.1e-31 PFAM
RRM 278 346 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116415
SMART Domains Protein: ENSMUSP00000112116
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 2.3e-36 PFAM
RRM 297 365 2.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126431
SMART Domains Protein: ENSMUSP00000119673
Gene: ENSMUSG00000031816

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:5-FTHF_cyc-lig 81 278 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128052
Predicted Effect probably benign
Transcript: ENSMUST00000133037
AA Change: S316P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117429
Gene: ENSMUSG00000031816
AA Change: S316P

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 7.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139782
AA Change: S297P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115382
Gene: ENSMUSG00000031816
AA Change: S297P

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134758
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,615,989 (GRCm39) W508L probably damaging Het
Abt1 G T 13: 23,606,439 (GRCm39) Q172K probably damaging Het
Aoah C A 13: 21,000,738 (GRCm39) H57Q probably damaging Het
Cpxm2 T C 7: 131,756,242 (GRCm39) E34G probably benign Het
Ddx25 C T 9: 35,457,265 (GRCm39) R350Q probably benign Het
Dnah9 G A 11: 65,965,944 (GRCm39) H1691Y probably null Het
Doc2g A T 19: 4,056,571 (GRCm39) H319L probably benign Het
Enah A C 1: 181,841,911 (GRCm39) V6G unknown Het
Fam135b T G 15: 71,335,689 (GRCm39) T502P probably benign Het
Frem2 A G 3: 53,562,918 (GRCm39) S530P possibly damaging Het
Gm19410 A G 8: 36,252,938 (GRCm39) R628G possibly damaging Het
Hdac7 T C 15: 97,699,989 (GRCm39) T614A probably benign Het
Ift88 T A 14: 57,672,256 (GRCm39) L32* probably null Het
Insm2 C T 12: 55,647,390 (GRCm39) T378M possibly damaging Het
Kctd3 G A 1: 188,710,786 (GRCm39) T459M probably damaging Het
Khsrp A G 17: 57,332,925 (GRCm39) L188P probably benign Het
Kynu A G 2: 43,569,881 (GRCm39) I388V probably benign Het
Met T C 6: 17,555,561 (GRCm39) V1090A probably damaging Het
Mier1 C T 4: 103,019,725 (GRCm39) T483I probably benign Het
P2rx5 A T 11: 73,058,341 (GRCm39) I259F probably damaging Het
Pax3 A G 1: 78,170,415 (GRCm39) L138P probably damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Rbm12 A T 2: 155,938,546 (GRCm39) H575Q probably benign Het
Scube1 C T 15: 83,492,465 (GRCm39) R953H probably benign Het
Sirt1 A G 10: 63,156,516 (GRCm39) S705P probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc46a3 T C 5: 147,823,234 (GRCm39) T203A probably benign Het
Snta1 G T 2: 154,222,889 (GRCm39) T278K probably benign Het
Stac3 A G 10: 127,344,083 (GRCm39) D327G possibly damaging Het
Timm44 C A 8: 4,317,707 (GRCm39) E205* probably null Het
Timm8a2 A T 14: 122,272,216 (GRCm39) T40S probably damaging Het
Vmn2r116 A G 17: 23,620,360 (GRCm39) N698S possibly damaging Het
Zik1 A C 7: 10,223,716 (GRCm39) C460W possibly damaging Het
Zmynd8 A C 2: 165,680,746 (GRCm39) I229S possibly damaging Het
Other mutations in Mthfsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Mthfsd APN 8 121,831,207 (GRCm39) missense probably damaging 1.00
IGL03002:Mthfsd APN 8 121,835,018 (GRCm39) splice site probably benign
R0076:Mthfsd UTSW 8 121,825,478 (GRCm39) missense probably benign 0.04
R0416:Mthfsd UTSW 8 121,827,976 (GRCm39) missense probably damaging 1.00
R0745:Mthfsd UTSW 8 121,829,688 (GRCm39) missense probably damaging 1.00
R2157:Mthfsd UTSW 8 121,828,240 (GRCm39) missense probably damaging 1.00
R2851:Mthfsd UTSW 8 121,832,512 (GRCm39) missense probably benign 0.38
R3439:Mthfsd UTSW 8 121,825,860 (GRCm39) missense possibly damaging 0.89
R4207:Mthfsd UTSW 8 121,832,365 (GRCm39) missense probably damaging 1.00
R4456:Mthfsd UTSW 8 121,832,504 (GRCm39) missense possibly damaging 0.89
R4757:Mthfsd UTSW 8 121,825,737 (GRCm39) critical splice donor site probably null
R5154:Mthfsd UTSW 8 121,825,479 (GRCm39) missense probably damaging 1.00
R5208:Mthfsd UTSW 8 121,835,058 (GRCm39) unclassified probably benign
R5496:Mthfsd UTSW 8 121,825,553 (GRCm39) nonsense probably null
R6652:Mthfsd UTSW 8 121,825,560 (GRCm39) missense probably damaging 1.00
R7309:Mthfsd UTSW 8 121,835,070 (GRCm39) unclassified probably benign
R7538:Mthfsd UTSW 8 121,825,525 (GRCm39) missense probably benign 0.41
R8072:Mthfsd UTSW 8 121,825,555 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTCCATCCTGCTAAACTG -3'
(R):5'- CACACCTGGGCAGTTTCTTG -3'

Sequencing Primer
(F):5'- TCCCACTGGGACATCAATGGTAAG -3'
(R):5'- ACACCTGGGCAGTTTCTTGTTTTTAC -3'
Posted On 2022-11-14