Incidental Mutation 'R9759:Vmn2r116'
ID 732918
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23603777-23620838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23620360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 698 (N698S)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect possibly damaging
Transcript: ENSMUST00000164856
AA Change: N698S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: N698S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,615,989 (GRCm39) W508L probably damaging Het
Abt1 G T 13: 23,606,439 (GRCm39) Q172K probably damaging Het
Aoah C A 13: 21,000,738 (GRCm39) H57Q probably damaging Het
Cpxm2 T C 7: 131,756,242 (GRCm39) E34G probably benign Het
Ddx25 C T 9: 35,457,265 (GRCm39) R350Q probably benign Het
Dnah9 G A 11: 65,965,944 (GRCm39) H1691Y probably null Het
Doc2g A T 19: 4,056,571 (GRCm39) H319L probably benign Het
Enah A C 1: 181,841,911 (GRCm39) V6G unknown Het
Fam135b T G 15: 71,335,689 (GRCm39) T502P probably benign Het
Frem2 A G 3: 53,562,918 (GRCm39) S530P possibly damaging Het
Gm19410 A G 8: 36,252,938 (GRCm39) R628G possibly damaging Het
Hdac7 T C 15: 97,699,989 (GRCm39) T614A probably benign Het
Ift88 T A 14: 57,672,256 (GRCm39) L32* probably null Het
Insm2 C T 12: 55,647,390 (GRCm39) T378M possibly damaging Het
Kctd3 G A 1: 188,710,786 (GRCm39) T459M probably damaging Het
Khsrp A G 17: 57,332,925 (GRCm39) L188P probably benign Het
Kynu A G 2: 43,569,881 (GRCm39) I388V probably benign Het
Met T C 6: 17,555,561 (GRCm39) V1090A probably damaging Het
Mier1 C T 4: 103,019,725 (GRCm39) T483I probably benign Het
Mthfsd A G 8: 121,824,615 (GRCm39) S297P probably benign Het
P2rx5 A T 11: 73,058,341 (GRCm39) I259F probably damaging Het
Pax3 A G 1: 78,170,415 (GRCm39) L138P probably damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Rbm12 A T 2: 155,938,546 (GRCm39) H575Q probably benign Het
Scube1 C T 15: 83,492,465 (GRCm39) R953H probably benign Het
Sirt1 A G 10: 63,156,516 (GRCm39) S705P probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc46a3 T C 5: 147,823,234 (GRCm39) T203A probably benign Het
Snta1 G T 2: 154,222,889 (GRCm39) T278K probably benign Het
Stac3 A G 10: 127,344,083 (GRCm39) D327G possibly damaging Het
Timm44 C A 8: 4,317,707 (GRCm39) E205* probably null Het
Timm8a2 A T 14: 122,272,216 (GRCm39) T40S probably damaging Het
Zik1 A C 7: 10,223,716 (GRCm39) C460W possibly damaging Het
Zmynd8 A C 2: 165,680,746 (GRCm39) I229S possibly damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23,604,969 (GRCm39) missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23,620,489 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23,606,210 (GRCm39) missense probably benign 0.12
IGL00990:Vmn2r116 APN 17 23,616,701 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r116 APN 17 23,620,575 (GRCm39) missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23,603,903 (GRCm39) missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23,605,619 (GRCm39) missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23,616,601 (GRCm39) splice site probably benign
IGL02170:Vmn2r116 APN 17 23,603,907 (GRCm39) missense probably benign
IGL02209:Vmn2r116 APN 17 23,607,761 (GRCm39) missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23,603,808 (GRCm39) missense probably null
IGL02272:Vmn2r116 APN 17 23,604,978 (GRCm39) missense probably damaging 1.00
IGL02272:Vmn2r116 APN 17 23,604,973 (GRCm39) missense probably benign 0.06
IGL02403:Vmn2r116 APN 17 23,606,338 (GRCm39) missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23,607,767 (GRCm39) missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23,616,608 (GRCm39) splice site probably benign
IGL02977:Vmn2r116 APN 17 23,607,748 (GRCm39) missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23,607,921 (GRCm39) missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23,620,823 (GRCm39) missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23,605,072 (GRCm39) nonsense probably null
R0281:Vmn2r116 UTSW 17 23,620,387 (GRCm39) missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23,606,253 (GRCm39) missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23,605,889 (GRCm39) missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23,606,286 (GRCm39) missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23,605,861 (GRCm39) missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23,619,934 (GRCm39) missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23,606,162 (GRCm39) missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23,605,115 (GRCm39) missense probably benign
R1401:Vmn2r116 UTSW 17 23,605,570 (GRCm39) splice site probably benign
R1574:Vmn2r116 UTSW 17 23,606,063 (GRCm39) missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23,606,063 (GRCm39) missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23,620,740 (GRCm39) missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23,620,443 (GRCm39) missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23,605,025 (GRCm39) missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23,603,798 (GRCm39) missense unknown
R4298:Vmn2r116 UTSW 17 23,620,801 (GRCm39) missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23,620,395 (GRCm39) missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23,620,777 (GRCm39) missense probably benign
R4941:Vmn2r116 UTSW 17 23,620,116 (GRCm39) missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23,606,138 (GRCm39) missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23,605,778 (GRCm39) missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23,605,095 (GRCm39) missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23,620,041 (GRCm39) missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23,616,693 (GRCm39) missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23,620,378 (GRCm39) missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23,604,942 (GRCm39) missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23,606,281 (GRCm39) missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23,606,054 (GRCm39) missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23,606,351 (GRCm39) missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23,605,736 (GRCm39) missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23,607,805 (GRCm39) nonsense probably null
R6667:Vmn2r116 UTSW 17 23,620,066 (GRCm39) missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23,605,099 (GRCm39) missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23,603,830 (GRCm39) splice site probably null
R7940:Vmn2r116 UTSW 17 23,605,946 (GRCm39) missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23,604,905 (GRCm39) nonsense probably null
R8950:Vmn2r116 UTSW 17 23,620,467 (GRCm39) missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23,605,736 (GRCm39) missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23,605,916 (GRCm39) missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23,603,864 (GRCm39) missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23,604,956 (GRCm39) missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23,620,141 (GRCm39) missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23,620,566 (GRCm39) missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23,605,919 (GRCm39) missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23,620,797 (GRCm39) missense probably benign 0.08
R9755:Vmn2r116 UTSW 17 23,620,065 (GRCm39) missense probably damaging 1.00
R9800:Vmn2r116 UTSW 17 23,620,399 (GRCm39) missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23,606,253 (GRCm39) missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23,620,402 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23,607,866 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGATCTTTGTGAAGCACCAC -3'
(R):5'- AGAGTGAAGCTCCCAAAGGC -3'

Sequencing Primer
(F):5'- TGTTAAGGCCAATAACAGAACTCTC -3'
(R):5'- GCTCCCAAAGGCCAGGATAG -3'
Posted On 2022-11-14