Incidental Mutation 'R9759:Pfpl'
ID 732921
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Name pore forming protein-like
Synonyms Epcs5, Epcs50
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R9759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12405290-12409474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 12406297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 183 (E183Q)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
AlphaFold Q5RKV8
Predicted Effect probably damaging
Transcript: ENSMUST00000168148
AA Change: E183Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: E183Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,615,989 (GRCm39) W508L probably damaging Het
Abt1 G T 13: 23,606,439 (GRCm39) Q172K probably damaging Het
Aoah C A 13: 21,000,738 (GRCm39) H57Q probably damaging Het
Cpxm2 T C 7: 131,756,242 (GRCm39) E34G probably benign Het
Ddx25 C T 9: 35,457,265 (GRCm39) R350Q probably benign Het
Dnah9 G A 11: 65,965,944 (GRCm39) H1691Y probably null Het
Doc2g A T 19: 4,056,571 (GRCm39) H319L probably benign Het
Enah A C 1: 181,841,911 (GRCm39) V6G unknown Het
Fam135b T G 15: 71,335,689 (GRCm39) T502P probably benign Het
Frem2 A G 3: 53,562,918 (GRCm39) S530P possibly damaging Het
Gm19410 A G 8: 36,252,938 (GRCm39) R628G possibly damaging Het
Hdac7 T C 15: 97,699,989 (GRCm39) T614A probably benign Het
Ift88 T A 14: 57,672,256 (GRCm39) L32* probably null Het
Insm2 C T 12: 55,647,390 (GRCm39) T378M possibly damaging Het
Kctd3 G A 1: 188,710,786 (GRCm39) T459M probably damaging Het
Khsrp A G 17: 57,332,925 (GRCm39) L188P probably benign Het
Kynu A G 2: 43,569,881 (GRCm39) I388V probably benign Het
Met T C 6: 17,555,561 (GRCm39) V1090A probably damaging Het
Mier1 C T 4: 103,019,725 (GRCm39) T483I probably benign Het
Mthfsd A G 8: 121,824,615 (GRCm39) S297P probably benign Het
P2rx5 A T 11: 73,058,341 (GRCm39) I259F probably damaging Het
Pax3 A G 1: 78,170,415 (GRCm39) L138P probably damaging Het
Rbm12 A T 2: 155,938,546 (GRCm39) H575Q probably benign Het
Scube1 C T 15: 83,492,465 (GRCm39) R953H probably benign Het
Sirt1 A G 10: 63,156,516 (GRCm39) S705P probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc46a3 T C 5: 147,823,234 (GRCm39) T203A probably benign Het
Snta1 G T 2: 154,222,889 (GRCm39) T278K probably benign Het
Stac3 A G 10: 127,344,083 (GRCm39) D327G possibly damaging Het
Timm44 C A 8: 4,317,707 (GRCm39) E205* probably null Het
Timm8a2 A T 14: 122,272,216 (GRCm39) T40S probably damaging Het
Vmn2r116 A G 17: 23,620,360 (GRCm39) N698S possibly damaging Het
Zik1 A C 7: 10,223,716 (GRCm39) C460W possibly damaging Het
Zmynd8 A C 2: 165,680,746 (GRCm39) I229S possibly damaging Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12,407,009 (GRCm39) missense probably benign 0.00
IGL01298:Pfpl APN 19 12,406,037 (GRCm39) missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12,405,974 (GRCm39) missense probably damaging 1.00
IGL02273:Pfpl APN 19 12,407,327 (GRCm39) missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12,406,209 (GRCm39) missense probably damaging 1.00
IGL02611:Pfpl APN 19 12,407,647 (GRCm39) missense probably benign
IGL02642:Pfpl APN 19 12,407,107 (GRCm39) missense probably damaging 1.00
IGL02715:Pfpl APN 19 12,407,145 (GRCm39) nonsense probably null
IGL03087:Pfpl APN 19 12,406,241 (GRCm39) missense probably benign 0.06
IGL03223:Pfpl APN 19 12,407,438 (GRCm39) missense probably damaging 1.00
IGL03253:Pfpl APN 19 12,407,393 (GRCm39) missense probably damaging 0.99
pegged UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
D3080:Pfpl UTSW 19 12,406,196 (GRCm39) missense probably damaging 0.98
R0276:Pfpl UTSW 19 12,406,601 (GRCm39) missense probably damaging 1.00
R0433:Pfpl UTSW 19 12,406,839 (GRCm39) missense probably damaging 1.00
R1004:Pfpl UTSW 19 12,407,789 (GRCm39) missense probably benign 0.00
R1510:Pfpl UTSW 19 12,407,060 (GRCm39) missense probably benign 0.31
R1759:Pfpl UTSW 19 12,407,224 (GRCm39) missense probably damaging 1.00
R2009:Pfpl UTSW 19 12,407,319 (GRCm39) missense possibly damaging 0.95
R2063:Pfpl UTSW 19 12,407,237 (GRCm39) missense probably damaging 1.00
R2201:Pfpl UTSW 19 12,407,843 (GRCm39) missense probably benign 0.01
R2656:Pfpl UTSW 19 12,407,600 (GRCm39) missense probably benign
R2969:Pfpl UTSW 19 12,406,907 (GRCm39) missense probably benign 0.00
R3003:Pfpl UTSW 19 12,407,690 (GRCm39) missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12,407,677 (GRCm39) missense probably benign 0.37
R3904:Pfpl UTSW 19 12,407,801 (GRCm39) missense probably benign 0.00
R4049:Pfpl UTSW 19 12,407,053 (GRCm39) missense probably damaging 1.00
R4717:Pfpl UTSW 19 12,406,618 (GRCm39) missense probably benign 0.07
R5343:Pfpl UTSW 19 12,406,052 (GRCm39) missense probably damaging 0.99
R5804:Pfpl UTSW 19 12,407,027 (GRCm39) missense probably benign 0.00
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6047:Pfpl UTSW 19 12,406,597 (GRCm39) missense probably damaging 1.00
R6106:Pfpl UTSW 19 12,406,825 (GRCm39) missense probably damaging 0.99
R6657:Pfpl UTSW 19 12,407,290 (GRCm39) missense probably benign 0.36
R7467:Pfpl UTSW 19 12,405,878 (GRCm39) missense probably damaging 1.00
R7720:Pfpl UTSW 19 12,406,538 (GRCm39) missense probably benign 0.02
R8024:Pfpl UTSW 19 12,407,570 (GRCm39) missense possibly damaging 0.94
R8370:Pfpl UTSW 19 12,407,275 (GRCm39) missense probably damaging 0.99
R8730:Pfpl UTSW 19 12,405,944 (GRCm39) missense probably damaging 1.00
R8974:Pfpl UTSW 19 12,405,839 (GRCm39) missense probably damaging 1.00
R9147:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9148:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9248:Pfpl UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
R9283:Pfpl UTSW 19 12,406,220 (GRCm39) missense probably damaging 1.00
R9542:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9560:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9561:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9663:Pfpl UTSW 19 12,407,459 (GRCm39) missense probably damaging 1.00
R9670:Pfpl UTSW 19 12,407,107 (GRCm39) missense probably damaging 1.00
R9721:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9722:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9723:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9761:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9762:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
Z1176:Pfpl UTSW 19 12,407,305 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATCGTCCCAGAGTCAACGG -3'
(R):5'- AGCCTGTCTCTATTTTGAAGTTCAC -3'

Sequencing Primer
(F):5'- AGTCAACGGCAAGTTCTCTTCTGAG -3'
(R):5'- TGAAGTTCACAACCTTTGCG -3'
Posted On 2022-11-14