Mutagenetix > Incidental Mutation

Incidental Mutation 'R9760:Esrrg'

732925

Institutional Source

Beutler Lab

Gene Symbol

Esrrg

Ensembl Gene

ENSMUSG00000026610

Gene Name

estrogen-related receptor gamma

Synonyms

ERR3, estrogen-related receptor 3, NR3B3, Errg

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9760 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

187608791-188214885 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 188043372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 32 (D32G)

Ref Sequence

ENSEMBL: ENSMUSP00000027906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939] [ENSMUST00000127489]

AlphaFold

P62509

PDB Structure

crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with diethylstilbestrol [X-RAY DIFFRACTION]
crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with 4-hydroxytamoxifen [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000027906
AA Change: D32G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: D32G

Domain	Start	End	E-Value	Type
low complexity region	57	70	N/A	INTRINSIC
ZnF_C4	125	196	4.04e-40	SMART
Blast:HOLI	203	233	5e-6	BLAST
HOLI	270	428	1.64e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110938
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: D9G

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110939
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: D9G

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127489
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119286
Gene: ENSMUSG00000026610
AA Change: D9G

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.1%
20x: 97.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	C	16: 8,581,930		probably null	Het
Adamts4	G	A	1: 171,258,765	D709N	probably benign	Het
Arhgef12	G	T	9: 42,992,022	D745E	probably damaging	Het
BC005561	T	C	5: 104,519,235	V541A	probably benign	Het
Cep250	A	G	2: 155,976,553	K883E	probably benign	Het
Cfdp1	T	C	8: 111,768,783	I268V	probably benign	Het
Cgnl1	G	T	9: 71,645,571	S1037*	probably null	Het
Clca3b	T	C	3: 144,846,849	N142S	probably benign	Het
Col6a6	A	T	9: 105,782,054	I564N	probably damaging	Het
Coq4	G	T	2: 29,788,470	R36L	probably benign	Het
Dact3	G	A	7: 16,886,206	S542N	unknown	Het
Dcaf1	A	G	9: 106,874,267	D1480G	unknown	Het
Dcdc2a	C	T	13: 25,205,460	T457I	probably damaging	Het
Ddi2	A	G	4: 141,683,885	V572A	probably damaging	Het
Ddx54	C	T	5: 120,623,607	R483C	probably benign	Het
Dennd5b	G	A	6: 149,068,499	S152F	probably benign	Het
Efcab14	C	T	4: 115,758,875	H252Y	probably benign	Het
Efhb	A	T	17: 53,463,270	F4I	probably damaging	Het
Fam126a	T	C	5: 23,979,574	Q302R	possibly damaging	Het
Fam160b2	A	C	14: 70,590,181	V158G	possibly damaging	Het
Far2	C	A	6: 148,158,950	A267E	probably damaging	Het
Flnb	T	C	14: 7,929,846	I1992T	probably damaging	Het
Fmnl2	A	G	2: 53,054,515	S169G		Het
Galnt10	G	A	11: 57,765,688	V233I	probably benign	Het
Gbf1	C	A	19: 46,255,698	N210K	probably benign	Het
Gbp3	T	G	3: 142,570,522	S460A	probably benign	Het
Gm12185	T	A	11: 48,915,341	H341L	probably benign	Het
Gm14025	A	T	2: 129,038,579	S476T		Het
Gm5592	A	T	7: 41,289,810	I839F	possibly damaging	Het
Gnptab	A	G	10: 88,431,448	D467G	probably damaging	Het
Grin3a	A	T	4: 49,714,213	M844K	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,592	D368G	probably benign	Het
Herc2	G	C	7: 56,163,911		probably null	Het
Ins2	T	A	7: 142,679,448	H29L	probably damaging	Het
Ipo13	T	A	4: 117,905,581	Y275F	probably benign	Het
Kcnj15	T	A	16: 95,295,624	M35K	probably benign	Het
Kif21b	G	A	1: 136,148,683	V321M	probably damaging	Het
Lcmt1	T	A	7: 123,430,152	Y332*	probably null	Het
Malt1	A	G	18: 65,448,212	Q237R	probably benign	Het
Micall1	G	A	15: 79,120,832	C168Y	unknown	Het
Muc5ac	A	G	7: 141,807,248	K1432R	probably benign	Het
Nacad	A	G	11: 6,601,662	S510P	probably benign	Het
Nub1	T	C	5: 24,692,967	L117P	possibly damaging	Het
Olfr119	T	C	17: 37,701,543	L291P	probably damaging	Het
Olfr312	A	G	11: 58,832,026	R291G	probably damaging	Het
Olfr938	A	T	9: 39,077,975	F257I	possibly damaging	Het
Pkdrej	T	C	15: 85,821,067	K223E	probably benign	Het
Prkdc	T	A	16: 15,839,180	Y4046*	probably null	Het
Prpf8	A	G	11: 75,503,431	N1767D	probably benign	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
R3hdm2	G	T	10: 127,444,313	M18I	unknown	Het
Rab35	C	A	5: 115,640,165	D63E	probably damaging	Het
Ribc2	T	A	15: 85,143,367	Y350N	probably benign	Het
Sec63	A	G	10: 42,828,948	I733V	probably benign	Het
Slc23a3	ATT	ATTT	1: 75,133,281		probably null	Het
Slc38a4	T	C	15: 96,998,451	K512E	probably damaging	Het
Stk35	G	A	2: 129,800,685	V49I	probably benign	Het
Tango6	A	G	8: 106,850,279	E1055G	probably damaging	Het
Tas2r137	A	G	6: 40,492,102	I289V	probably benign	Het
Tll2	C	T	19: 41,130,645	V215M	probably damaging	Het
Tmem30a	A	T	9: 79,780,592	N98K	probably benign	Het
Trav9n-4	C	A	14: 53,294,833	A48E	probably benign	Het
Vmn1r192	A	G	13: 22,187,840	F70S	probably damaging	Het
Wdr89	A	G	12: 75,633,252	V76A	probably damaging	Het
Zfp229	A	T	17: 21,746,294	T502S	probably damaging	Het

Other mutations in Esrrg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Esrrg	APN	1	188210910	missense	probably damaging	1.00
IGL01635:Esrrg	APN	1	188198600	missense	probably damaging	1.00
IGL01642:Esrrg	APN	1	188210915	missense	probably benign	0.01
IGL02740:Esrrg	APN	1	188198741	missense	probably benign	0.04
IGL03126:Esrrg	APN	1	187997987	intron	probably benign
IGL03391:Esrrg	APN	1	188150223	missense	possibly damaging	0.70
R0395:Esrrg	UTSW	1	188198635	missense	probably damaging	1.00
R0645:Esrrg	UTSW	1	188043341	missense	probably benign	0.00
R1593:Esrrg	UTSW	1	188066385	missense	possibly damaging	0.94
R1700:Esrrg	UTSW	1	188043653	missense	probably damaging	1.00
R1855:Esrrg	UTSW	1	188211098	missense	probably damaging	1.00
R3552:Esrrg	UTSW	1	188150190	missense	probably benign	0.05
R3605:Esrrg	UTSW	1	188211102	missense	possibly damaging	0.74
R4384:Esrrg	UTSW	1	188043711	missense	probably damaging	1.00
R5255:Esrrg	UTSW	1	188146358	missense	probably damaging	1.00
R5443:Esrrg	UTSW	1	188043425	missense	possibly damaging	0.78
R5511:Esrrg	UTSW	1	188211107	missense	probably damaging	1.00
R5516:Esrrg	UTSW	1	188198730	missense	possibly damaging	0.56
R5543:Esrrg	UTSW	1	188150254	missense	probably damaging	0.96
R5686:Esrrg	UTSW	1	188150198	missense	probably benign	0.24
R5990:Esrrg	UTSW	1	188198798	missense	probably damaging	1.00
R6030:Esrrg	UTSW	1	188198707	missense	probably benign	0.04
R6030:Esrrg	UTSW	1	188198707	missense	probably benign	0.04
R7058:Esrrg	UTSW	1	188150306	missense	probably damaging	1.00
R7487:Esrrg	UTSW	1	188146423	missense	probably benign	0.03
R8512:Esrrg	UTSW	1	188043580	nonsense	probably null
R8735:Esrrg	UTSW	1	188201008	intron	probably benign
R8973:Esrrg	UTSW	1	188198750	missense	possibly damaging	0.79
R8986:Esrrg	UTSW	1	188210907	missense	possibly damaging	0.60
R9114:Esrrg	UTSW	1	188146408	missense	probably benign	0.01
R9114:Esrrg	UTSW	1	188146409	missense	possibly damaging	0.75
R9483:Esrrg	UTSW	1	188198651	missense	probably damaging	0.97
Z1088:Esrrg	UTSW	1	188150218	missense	probably benign	0.04
Z1177:Esrrg	UTSW	1	188043555	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCTTAGGAAGCACTCTTAAAGAG -3'
(R):5'- TCATACAGTTTCCGGACAGGC -3'

Sequencing Primer
(F):5'- GCAATGCCTTTAACATACCAATATGC -3'
(R):5'- TCCCAGGATCGGAGCAGAG -3'

Posted On

2022-11-14