Mutagenetix > Incidental Mutation

Incidental Mutation 'R9760:Cgnl1'

732956

Institutional Source

Beutler Lab

Gene Symbol

Cgnl1

Ensembl Gene

ENSMUSG00000032232

Gene Name

cingulin-like 1

Synonyms

Jacop, 9930020M10Rik, 4933421H10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9760 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71626509-71771602 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 71645571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 1037 (S1037*)

Ref Sequence

ENSEMBL: ENSMUSP00000112479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000072899
AA Change: S1037*

SMART Domains

Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: S1037*

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
low complexity region	728	739	N/A	INTRINSIC
Pfam:Myosin_tail_1	984	1255	5.4e-30	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121322
AA Change: S966*

SMART Domains

Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: S966*

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
Pfam:Myosin_tail_1	909	1184	2.3e-30	PFAM
low complexity region	1187	1207	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000122065
AA Change: S1037*

SMART Domains

Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: S1037*

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
Pfam:Myosin_tail_1	582	1034	1.3e-12	PFAM
Pfam:Myosin_tail_1	1011	1253	7.7e-38	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.1%
20x: 97.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	C	16: 8,581,930		probably null	Het
Adamts4	G	A	1: 171,258,765	D709N	probably benign	Het
Arhgef12	G	T	9: 42,992,022	D745E	probably damaging	Het
BC005561	T	C	5: 104,519,235	V541A	probably benign	Het
Cep250	A	G	2: 155,976,553	K883E	probably benign	Het
Cfdp1	T	C	8: 111,768,783	I268V	probably benign	Het
Clca3b	T	C	3: 144,846,849	N142S	probably benign	Het
Col6a6	A	T	9: 105,782,054	I564N	probably damaging	Het
Coq4	G	T	2: 29,788,470	R36L	probably benign	Het
Dact3	G	A	7: 16,886,206	S542N	unknown	Het
Dcaf1	A	G	9: 106,874,267	D1480G	unknown	Het
Dcdc2a	C	T	13: 25,205,460	T457I	probably damaging	Het
Ddi2	A	G	4: 141,683,885	V572A	probably damaging	Het
Ddx54	C	T	5: 120,623,607	R483C	probably benign	Het
Dennd5b	G	A	6: 149,068,499	S152F	probably benign	Het
Efcab14	C	T	4: 115,758,875	H252Y	probably benign	Het
Efhb	A	T	17: 53,463,270	F4I	probably damaging	Het
Esrrg	A	G	1: 188,043,372	D32G	probably benign	Het
Fam126a	T	C	5: 23,979,574	Q302R	possibly damaging	Het
Fam160b2	A	C	14: 70,590,181	V158G	possibly damaging	Het
Far2	C	A	6: 148,158,950	A267E	probably damaging	Het
Flnb	T	C	14: 7,929,846	I1992T	probably damaging	Het
Fmnl2	A	G	2: 53,054,515	S169G		Het
Galnt10	G	A	11: 57,765,688	V233I	probably benign	Het
Gbf1	C	A	19: 46,255,698	N210K	probably benign	Het
Gbp3	T	G	3: 142,570,522	S460A	probably benign	Het
Gm12185	T	A	11: 48,915,341	H341L	probably benign	Het
Gm14025	A	T	2: 129,038,579	S476T		Het
Gm5592	A	T	7: 41,289,810	I839F	possibly damaging	Het
Gnptab	A	G	10: 88,431,448	D467G	probably damaging	Het
Grin3a	A	T	4: 49,714,213	M844K	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,592	D368G	probably benign	Het
Herc2	G	C	7: 56,163,911		probably null	Het
Ins2	T	A	7: 142,679,448	H29L	probably damaging	Het
Ipo13	T	A	4: 117,905,581	Y275F	probably benign	Het
Kcnj15	T	A	16: 95,295,624	M35K	probably benign	Het
Kif21b	G	A	1: 136,148,683	V321M	probably damaging	Het
Lcmt1	T	A	7: 123,430,152	Y332*	probably null	Het
Malt1	A	G	18: 65,448,212	Q237R	probably benign	Het
Micall1	G	A	15: 79,120,832	C168Y	unknown	Het
Muc5ac	A	G	7: 141,807,248	K1432R	probably benign	Het
Nacad	A	G	11: 6,601,662	S510P	probably benign	Het
Nub1	T	C	5: 24,692,967	L117P	possibly damaging	Het
Olfr119	T	C	17: 37,701,543	L291P	probably damaging	Het
Olfr312	A	G	11: 58,832,026	R291G	probably damaging	Het
Olfr938	A	T	9: 39,077,975	F257I	possibly damaging	Het
Pkdrej	T	C	15: 85,821,067	K223E	probably benign	Het
Prkdc	T	A	16: 15,839,180	Y4046*	probably null	Het
Prpf8	A	G	11: 75,503,431	N1767D	probably benign	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
R3hdm2	G	T	10: 127,444,313	M18I	unknown	Het
Rab35	C	A	5: 115,640,165	D63E	probably damaging	Het
Ribc2	T	A	15: 85,143,367	Y350N	probably benign	Het
Sec63	A	G	10: 42,828,948	I733V	probably benign	Het
Slc23a3	ATT	ATTT	1: 75,133,281		probably null	Het
Slc38a4	T	C	15: 96,998,451	K512E	probably damaging	Het
Stk35	G	A	2: 129,800,685	V49I	probably benign	Het
Tango6	A	G	8: 106,850,279	E1055G	probably damaging	Het
Tas2r137	A	G	6: 40,492,102	I289V	probably benign	Het
Tll2	C	T	19: 41,130,645	V215M	probably damaging	Het
Tmem30a	A	T	9: 79,780,592	N98K	probably benign	Het
Trav9n-4	C	A	14: 53,294,833	A48E	probably benign	Het
Vmn1r192	A	G	13: 22,187,840	F70S	probably damaging	Het
Wdr89	A	G	12: 75,633,252	V76A	probably damaging	Het
Zfp229	A	T	17: 21,746,294	T502S	probably damaging	Het

Other mutations in Cgnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Cgnl1	APN	9	71656056	missense	probably benign	0.00
IGL01128:Cgnl1	APN	9	71724561	missense	possibly damaging	0.81
IGL01450:Cgnl1	APN	9	71631862	splice site	probably benign
IGL01788:Cgnl1	APN	9	71655390	missense	probably benign
IGL01806:Cgnl1	APN	9	71650322	missense	probably damaging	0.99
IGL01906:Cgnl1	APN	9	71724567	missense	probably benign	0.00
IGL01933:Cgnl1	APN	9	71645483	splice site	probably benign
IGL01939:Cgnl1	APN	9	71725004	missense	probably damaging	1.00
IGL01947:Cgnl1	APN	9	71725044	missense	probably damaging	0.99
IGL02127:Cgnl1	APN	9	71725853	missense	probably damaging	1.00
IGL02379:Cgnl1	APN	9	71645553	missense	possibly damaging	0.82
IGL02510:Cgnl1	APN	9	71725357	missense	probably benign	0.41
FR4548:Cgnl1	UTSW	9	71724717	small insertion	probably benign
R0058:Cgnl1	UTSW	9	71724840	missense	probably damaging	0.99
R0058:Cgnl1	UTSW	9	71641397	missense	probably damaging	1.00
R0105:Cgnl1	UTSW	9	71656102	missense	probably benign
R0220:Cgnl1	UTSW	9	71724943	missense	possibly damaging	0.68
R0242:Cgnl1	UTSW	9	71721657	missense	probably damaging	1.00
R0401:Cgnl1	UTSW	9	71705239	missense	probably damaging	1.00
R0541:Cgnl1	UTSW	9	71651253	missense	possibly damaging	0.54
R1018:Cgnl1	UTSW	9	71726058	missense	probably damaging	1.00
R1026:Cgnl1	UTSW	9	71717431	missense	possibly damaging	0.91
R1056:Cgnl1	UTSW	9	71725895	missense	probably damaging	1.00
R1299:Cgnl1	UTSW	9	71721712	splice site	probably benign
R1513:Cgnl1	UTSW	9	71724590	missense	probably benign	0.02
R1546:Cgnl1	UTSW	9	71725815	missense	probably benign
R1599:Cgnl1	UTSW	9	71641427	missense	probably benign	0.02
R1657:Cgnl1	UTSW	9	71725944	missense	probably damaging	0.98
R1970:Cgnl1	UTSW	9	71725535	missense	probably benign	0.10
R2004:Cgnl1	UTSW	9	71630539	missense	probably damaging	1.00
R2080:Cgnl1	UTSW	9	71656096	missense	probably benign	0.01
R2085:Cgnl1	UTSW	9	71630878	missense	probably damaging	1.00
R2357:Cgnl1	UTSW	9	71725668	nonsense	probably null
R2402:Cgnl1	UTSW	9	71725179	missense	probably damaging	1.00
R3954:Cgnl1	UTSW	9	71724663	missense	probably benign	0.01
R4043:Cgnl1	UTSW	9	71705293	missense	probably damaging	1.00
R4127:Cgnl1	UTSW	9	71724540	missense	probably benign	0.00
R4825:Cgnl1	UTSW	9	71630524	missense	probably benign	0.00
R4851:Cgnl1	UTSW	9	71725032	missense	probably damaging	1.00
R4882:Cgnl1	UTSW	9	71717401	missense	probably benign	0.00
R4996:Cgnl1	UTSW	9	71724826	small deletion	probably benign
R5057:Cgnl1	UTSW	9	71724794	missense	probably damaging	0.99
R5263:Cgnl1	UTSW	9	71632654	nonsense	probably null
R5402:Cgnl1	UTSW	9	71629321	missense	probably damaging	1.00
R5744:Cgnl1	UTSW	9	71630675	splice site	probably null
R5770:Cgnl1	UTSW	9	71645487	splice site	probably null
R6911:Cgnl1	UTSW	9	71656215	missense	possibly damaging	0.82
R7014:Cgnl1	UTSW	9	71725134	missense	possibly damaging	0.86
R7106:Cgnl1	UTSW	9	71725733	missense	probably benign	0.00
R7203:Cgnl1	UTSW	9	71724533	missense	possibly damaging	0.80
R7231:Cgnl1	UTSW	9	71632645	missense	probably benign	0.39
R7241:Cgnl1	UTSW	9	71724770	missense	probably benign
R7288:Cgnl1	UTSW	9	71725564	missense	possibly damaging	0.67
R7327:Cgnl1	UTSW	9	71725883	missense	possibly damaging	0.48
R7390:Cgnl1	UTSW	9	71645649	missense	probably benign	0.04
R7529:Cgnl1	UTSW	9	71631758	missense	probably damaging	1.00
R7793:Cgnl1	UTSW	9	71725635	missense	probably damaging	1.00
R7975:Cgnl1	UTSW	9	71725322	missense	probably benign	0.00
R7990:Cgnl1	UTSW	9	71725265	missense	probably damaging	1.00
R8502:Cgnl1	UTSW	9	71630605	missense	probably damaging	0.99
R8926:Cgnl1	UTSW	9	71725253	missense	probably benign
R9010:Cgnl1	UTSW	9	71651349	missense	probably damaging	1.00
R9106:Cgnl1	UTSW	9	71721591	splice site	probably benign
R9189:Cgnl1	UTSW	9	71723565	nonsense	probably null
R9395:Cgnl1	UTSW	9	71632672	missense	probably benign	0.01
R9680:Cgnl1	UTSW	9	71655350	missense	possibly damaging	0.65
R9694:Cgnl1	UTSW	9	71725521	missense	probably benign	0.32
RF015:Cgnl1	UTSW	9	71724715	small insertion	probably benign
RF042:Cgnl1	UTSW	9	71724715	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCCAAGGCTTCCTATATCC -3'
(R):5'- TCTATCATTGCCAGAGCTATCC -3'

Sequencing Primer
(F):5'- TGGCCCAGACGTGTTCTC -3'
(R):5'- TCATTGCCAGAGCTATCCAATATC -3'

Posted On

2022-11-14