Mutagenetix > Incidental Mutation

Incidental Mutation 'R9760:Prpf8'

732967

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R9760 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75503431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1767 (N1767D)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510]

AlphaFold

Q99PV0

Predicted Effect

probably benign
Transcript: ENSMUST00000018449
AA Change: N1767D

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: N1767D

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102510
AA Change: N1767D

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: N1767D

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.1%
20x: 97.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	C	16: 8,581,930		probably null	Het
Adamts4	G	A	1: 171,258,765	D709N	probably benign	Het
Arhgef12	G	T	9: 42,992,022	D745E	probably damaging	Het
BC005561	T	C	5: 104,519,235	V541A	probably benign	Het
Cep250	A	G	2: 155,976,553	K883E	probably benign	Het
Cfdp1	T	C	8: 111,768,783	I268V	probably benign	Het
Cgnl1	G	T	9: 71,645,571	S1037*	probably null	Het
Clca3b	T	C	3: 144,846,849	N142S	probably benign	Het
Col6a6	A	T	9: 105,782,054	I564N	probably damaging	Het
Coq4	G	T	2: 29,788,470	R36L	probably benign	Het
Dact3	G	A	7: 16,886,206	S542N	unknown	Het
Dcaf1	A	G	9: 106,874,267	D1480G	unknown	Het
Dcdc2a	C	T	13: 25,205,460	T457I	probably damaging	Het
Ddi2	A	G	4: 141,683,885	V572A	probably damaging	Het
Ddx54	C	T	5: 120,623,607	R483C	probably benign	Het
Dennd5b	G	A	6: 149,068,499	S152F	probably benign	Het
Efcab14	C	T	4: 115,758,875	H252Y	probably benign	Het
Efhb	A	T	17: 53,463,270	F4I	probably damaging	Het
Esrrg	A	G	1: 188,043,372	D32G	probably benign	Het
Fam126a	T	C	5: 23,979,574	Q302R	possibly damaging	Het
Fam160b2	A	C	14: 70,590,181	V158G	possibly damaging	Het
Far2	C	A	6: 148,158,950	A267E	probably damaging	Het
Flnb	T	C	14: 7,929,846	I1992T	probably damaging	Het
Fmnl2	A	G	2: 53,054,515	S169G		Het
Galnt10	G	A	11: 57,765,688	V233I	probably benign	Het
Gbf1	C	A	19: 46,255,698	N210K	probably benign	Het
Gbp3	T	G	3: 142,570,522	S460A	probably benign	Het
Gm12185	T	A	11: 48,915,341	H341L	probably benign	Het
Gm14025	A	T	2: 129,038,579	S476T		Het
Gm5592	A	T	7: 41,289,810	I839F	possibly damaging	Het
Gnptab	A	G	10: 88,431,448	D467G	probably damaging	Het
Grin3a	A	T	4: 49,714,213	M844K	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,592	D368G	probably benign	Het
Herc2	G	C	7: 56,163,911		probably null	Het
Ins2	T	A	7: 142,679,448	H29L	probably damaging	Het
Ipo13	T	A	4: 117,905,581	Y275F	probably benign	Het
Kcnj15	T	A	16: 95,295,624	M35K	probably benign	Het
Kif21b	G	A	1: 136,148,683	V321M	probably damaging	Het
Lcmt1	T	A	7: 123,430,152	Y332*	probably null	Het
Malt1	A	G	18: 65,448,212	Q237R	probably benign	Het
Micall1	G	A	15: 79,120,832	C168Y	unknown	Het
Muc5ac	A	G	7: 141,807,248	K1432R	probably benign	Het
Nacad	A	G	11: 6,601,662	S510P	probably benign	Het
Nub1	T	C	5: 24,692,967	L117P	possibly damaging	Het
Olfr119	T	C	17: 37,701,543	L291P	probably damaging	Het
Olfr312	A	G	11: 58,832,026	R291G	probably damaging	Het
Olfr938	A	T	9: 39,077,975	F257I	possibly damaging	Het
Pkdrej	T	C	15: 85,821,067	K223E	probably benign	Het
Prkdc	T	A	16: 15,839,180	Y4046*	probably null	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
R3hdm2	G	T	10: 127,444,313	M18I	unknown	Het
Rab35	C	A	5: 115,640,165	D63E	probably damaging	Het
Ribc2	T	A	15: 85,143,367	Y350N	probably benign	Het
Sec63	A	G	10: 42,828,948	I733V	probably benign	Het
Slc23a3	ATT	ATTT	1: 75,133,281		probably null	Het
Slc38a4	T	C	15: 96,998,451	K512E	probably damaging	Het
Stk35	G	A	2: 129,800,685	V49I	probably benign	Het
Tango6	A	G	8: 106,850,279	E1055G	probably damaging	Het
Tas2r137	A	G	6: 40,492,102	I289V	probably benign	Het
Tll2	C	T	19: 41,130,645	V215M	probably damaging	Het
Tmem30a	A	T	9: 79,780,592	N98K	probably benign	Het
Trav9n-4	C	A	14: 53,294,833	A48E	probably benign	Het
Vmn1r192	A	G	13: 22,187,840	F70S	probably damaging	Het
Wdr89	A	G	12: 75,633,252	V76A	probably damaging	Het
Zfp229	A	T	17: 21,746,294	T502S	probably damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TTCATTCTCACAGTGCCTATGG -3'
(R):5'- TGAAGATGGCCCCATTGATG -3'

Sequencing Primer
(F):5'- CACAGTGCCTATGGAAACTGGTTC -3'
(R):5'- AGTTGTCAAGTTCCCCTCAAAGG -3'

Posted On

2022-11-14