Incidental Mutation 'R9760:Ribc2'
ID 732975
Institutional Source Beutler Lab
Gene Symbol Ribc2
Ensembl Gene ENSMUSG00000022431
Gene Name RIB43A domain with coiled-coils 2
Synonyms 4930579A10Rik, Trib
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9760 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 85016279-85028771 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85027568 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 350 (Y350N)
Ref Sequence ENSEMBL: ENSMUSP00000023067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023067] [ENSMUST00000229238]
AlphaFold Q9D4Q1
Predicted Effect probably benign
Transcript: ENSMUST00000023067
AA Change: Y350N

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023067
Gene: ENSMUSG00000022431
AA Change: Y350N

DomainStartEndE-ValueType
Pfam:RIB43A 3 377 9.7e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229238
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T C 16: 8,399,794 (GRCm39) probably null Het
Adamts4 G A 1: 171,086,334 (GRCm39) D709N probably benign Het
Arhgef12 G T 9: 42,903,318 (GRCm39) D745E probably damaging Het
Cep250 A G 2: 155,818,473 (GRCm39) K883E probably benign Het
Cfdp1 T C 8: 112,495,415 (GRCm39) I268V probably benign Het
Cgnl1 G T 9: 71,552,853 (GRCm39) S1037* probably null Het
Clca3b T C 3: 144,552,610 (GRCm39) N142S probably benign Het
Col6a6 A T 9: 105,659,253 (GRCm39) I564N probably damaging Het
Coq4 G T 2: 29,678,482 (GRCm39) R36L probably benign Het
Dact3 G A 7: 16,620,131 (GRCm39) S542N unknown Het
Dcaf1 A G 9: 106,751,466 (GRCm39) D1480G unknown Het
Dcdc2a C T 13: 25,389,443 (GRCm39) T457I probably damaging Het
Ddi2 A G 4: 141,411,196 (GRCm39) V572A probably damaging Het
Ddx54 C T 5: 120,761,672 (GRCm39) R483C probably benign Het
Dennd5b G A 6: 148,969,997 (GRCm39) S152F probably benign Het
Efcab14 C T 4: 115,616,072 (GRCm39) H252Y probably benign Het
Efhb A T 17: 53,770,298 (GRCm39) F4I probably damaging Het
Esrrg A G 1: 187,775,569 (GRCm39) D32G probably benign Het
Far2 C A 6: 148,060,448 (GRCm39) A267E probably damaging Het
Fhip2b A C 14: 70,827,621 (GRCm39) V158G possibly damaging Het
Flnb T C 14: 7,929,846 (GRCm38) I1992T probably damaging Het
Fmnl2 A G 2: 52,944,527 (GRCm39) S169G Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Gbf1 C A 19: 46,244,137 (GRCm39) N210K probably benign Het
Gbp3 T G 3: 142,276,283 (GRCm39) S460A probably benign Het
Gm12185 T A 11: 48,806,168 (GRCm39) H341L probably benign Het
Gm5592 A T 7: 40,939,234 (GRCm39) I839F possibly damaging Het
Gnptab A G 10: 88,267,310 (GRCm39) D467G probably damaging Het
Grin3a A T 4: 49,714,213 (GRCm39) M844K probably damaging Het
Gtf2a1l A G 17: 89,019,020 (GRCm39) D368G probably benign Het
Herc2 G C 7: 55,813,659 (GRCm39) probably null Het
Hycc1 T C 5: 24,184,572 (GRCm39) Q302R possibly damaging Het
Ins2 T A 7: 142,233,185 (GRCm39) H29L probably damaging Het
Ipo13 T A 4: 117,762,778 (GRCm39) Y275F probably benign Het
Kcnj15 T A 16: 95,096,483 (GRCm39) M35K probably benign Het
Kif21b G A 1: 136,076,421 (GRCm39) V321M probably damaging Het
Lcmt1 T A 7: 123,029,375 (GRCm39) Y332* probably null Het
Malt1 A G 18: 65,581,283 (GRCm39) Q237R probably benign Het
Micall1 G A 15: 79,005,032 (GRCm39) C168Y unknown Het
Muc5ac A G 7: 141,360,985 (GRCm39) K1432R probably benign Het
Nacad A G 11: 6,551,662 (GRCm39) S510P probably benign Het
Nub1 T C 5: 24,897,965 (GRCm39) L117P possibly damaging Het
Or10al3 T C 17: 38,012,434 (GRCm39) L291P probably damaging Het
Or5af1 A G 11: 58,722,852 (GRCm39) R291G probably damaging Het
Or8g24 A T 9: 38,989,271 (GRCm39) F257I possibly damaging Het
Pkdrej T C 15: 85,705,268 (GRCm39) K223E probably benign Het
Prkdc T A 16: 15,657,044 (GRCm39) Y4046* probably null Het
Prpf8 A G 11: 75,394,257 (GRCm39) N1767D probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
R3hdm2 G T 10: 127,280,182 (GRCm39) M18I unknown Het
Rab35 C A 5: 115,778,224 (GRCm39) D63E probably damaging Het
Sec63 A G 10: 42,704,944 (GRCm39) I733V probably benign Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc38a4 T C 15: 96,896,332 (GRCm39) K512E probably damaging Het
Stk35 G A 2: 129,642,605 (GRCm39) V49I probably benign Het
Tango6 A G 8: 107,576,911 (GRCm39) E1055G probably damaging Het
Tas2r140 A G 6: 40,469,036 (GRCm39) I289V probably benign Het
Thoc2l T C 5: 104,667,101 (GRCm39) V541A probably benign Het
Tll2 C T 19: 41,119,084 (GRCm39) V215M probably damaging Het
Tmem30a A T 9: 79,687,874 (GRCm39) N98K probably benign Het
Trav9n-4 C A 14: 53,532,290 (GRCm39) A48E probably benign Het
Vinac1 A T 2: 128,880,499 (GRCm39) S476T Het
Vmn1r192 A G 13: 22,372,010 (GRCm39) F70S probably damaging Het
Wdr89 A G 12: 75,680,026 (GRCm39) V76A probably damaging Het
Zfp229 A T 17: 21,965,275 (GRCm39) T502S probably damaging Het
Other mutations in Ribc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Ribc2 APN 15 85,027,536 (GRCm39) missense possibly damaging 0.95
IGL02816:Ribc2 APN 15 85,017,106 (GRCm39) missense probably damaging 0.99
IGL02830:Ribc2 APN 15 85,016,458 (GRCm39) utr 5 prime probably benign
IGL03336:Ribc2 APN 15 85,017,114 (GRCm39) nonsense probably null
IGL03350:Ribc2 APN 15 85,019,703 (GRCm39) missense probably damaging 1.00
R0583:Ribc2 UTSW 15 85,017,115 (GRCm39) splice site probably null
R3685:Ribc2 UTSW 15 85,019,535 (GRCm39) missense possibly damaging 0.89
R3943:Ribc2 UTSW 15 85,019,451 (GRCm39) missense probably benign 0.00
R3944:Ribc2 UTSW 15 85,019,451 (GRCm39) missense probably benign 0.00
R4758:Ribc2 UTSW 15 85,025,867 (GRCm39) missense probably damaging 1.00
R7234:Ribc2 UTSW 15 85,019,733 (GRCm39) missense probably benign 0.00
R7472:Ribc2 UTSW 15 85,019,446 (GRCm39) missense probably benign 0.33
R7567:Ribc2 UTSW 15 85,027,448 (GRCm39) missense probably damaging 0.98
R7653:Ribc2 UTSW 15 85,025,876 (GRCm39) missense probably benign 0.36
R8370:Ribc2 UTSW 15 85,027,489 (GRCm39) missense probably benign 0.00
R8443:Ribc2 UTSW 15 85,019,461 (GRCm39) missense probably benign 0.00
R8971:Ribc2 UTSW 15 85,016,337 (GRCm39) start gained probably benign
R9072:Ribc2 UTSW 15 85,022,163 (GRCm39) missense probably damaging 0.97
R9073:Ribc2 UTSW 15 85,022,163 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCCAAGAGAATCCCTTTTC -3'
(R):5'- CAGACTGACATGTGAAAGAGCC -3'

Sequencing Primer
(F):5'- AAGAGAATCCCTTTTCCTGCC -3'
(R):5'- AAAGAGCCTGGGAGCCCTC -3'
Posted On 2022-11-14