Incidental Mutation 'R9761:Myh13'
ID 733022
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, MyHC-eo, extraocular myosin
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9761 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67217929-67262413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67251294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1391 (E1391G)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably damaging
Transcript: ENSMUST00000081911
AA Change: E1391G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: E1391G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108684
AA Change: E1391G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: E1391G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122618
Predicted Effect probably damaging
Transcript: ENSMUST00000180845
AA Change: E1391G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: E1391G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 G A 6: 142,544,854 (GRCm39) T1411I possibly damaging Het
Ablim3 C A 18: 61,952,885 (GRCm39) R393L possibly damaging Het
Akap3 A G 6: 126,842,200 (GRCm39) D273G probably benign Het
Ankrd35 C T 3: 96,591,733 (GRCm39) T673I possibly damaging Het
Atp11b A T 3: 35,903,607 (GRCm39) K1114* probably null Het
Atp11b C T 3: 35,903,621 (GRCm39) P947L probably benign Het
Atp11b G T 3: 35,903,616 (GRCm39) D1117Y probably damaging Het
Cfap74 C A 4: 155,550,844 (GRCm39) H243Q unknown Het
Dgkh A T 14: 78,889,163 (GRCm39) S111R probably damaging Het
Dpp6 G A 5: 27,869,743 (GRCm39) R505K probably benign Het
Elp4 C T 2: 105,624,904 (GRCm39) G330S probably damaging Het
Fsip2 A T 2: 82,821,994 (GRCm39) N5909I probably benign Het
Gbp5 A G 3: 142,213,518 (GRCm39) D478G probably damaging Het
Gcn1 A G 5: 115,729,064 (GRCm39) M792V probably benign Het
Gpr152 T C 19: 4,193,227 (GRCm39) L256P probably damaging Het
Greb1 C T 12: 16,751,275 (GRCm39) M1006I probably benign Het
Gzf1 C T 2: 148,530,011 (GRCm39) S514L probably damaging Het
Helz C A 11: 107,560,874 (GRCm39) S1312* probably null Het
Hmcn1 T C 1: 150,868,625 (GRCm39) I60V probably damaging Het
Ift81 A C 5: 122,729,146 (GRCm39) D395E probably benign Het
Itfg1 T C 8: 86,563,031 (GRCm39) N123S probably benign Het
Klk1b1 C A 7: 43,618,739 (GRCm39) H39N possibly damaging Het
Klk1b24 A T 7: 43,839,779 (GRCm39) N46I possibly damaging Het
Klrg2 C A 6: 38,607,287 (GRCm39) W241L probably damaging Het
Lhx9 T C 1: 138,774,934 (GRCm39) N3S probably benign Het
Lrrc2 A G 9: 110,809,942 (GRCm39) D326G possibly damaging Het
Mansc1 A T 6: 134,587,004 (GRCm39) L391Q probably damaging Het
Mcidas G A 13: 113,135,453 (GRCm39) R292H probably benign Het
Ms4a19 T C 19: 11,119,754 (GRCm39) T59A probably benign Het
Or12d13 T A 17: 37,648,057 (GRCm39) Q22L possibly damaging Het
Or14j7 T C 17: 38,234,934 (GRCm39) F159S probably benign Het
Or4f53 C A 2: 111,087,606 (GRCm39) L49I probably benign Het
Or4f53 T G 2: 111,087,607 (GRCm39) L49R possibly damaging Het
Or8g26 T C 9: 39,096,146 (GRCm39) I221T probably damaging Het
Or8k20 C T 2: 86,106,150 (GRCm39) R227Q probably benign Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Poc1b C T 10: 98,965,356 (GRCm39) S95F probably benign Het
Pprc1 A G 19: 46,049,998 (GRCm39) I104V unknown Het
Prkar1b C A 5: 139,092,410 (GRCm39) V136L probably benign Het
Scn2a A G 2: 65,566,030 (GRCm39) I1351M probably damaging Het
Serpina3c G T 12: 104,118,089 (GRCm39) A83D probably damaging Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Syne1 A G 10: 5,318,190 (GRCm39) probably null Het
Ticrr A G 7: 79,345,313 (GRCm39) E1726G probably damaging Het
Tmprss12 T C 15: 100,190,529 (GRCm39) W300R probably damaging Het
Tnrc6c T A 11: 117,623,136 (GRCm39) H892Q probably benign Het
Tnxb A G 17: 34,903,987 (GRCm39) T1043A probably benign Het
Vps50 T A 6: 3,519,218 (GRCm39) V100D probably damaging Het
Zim1 G C 7: 6,680,771 (GRCm39) H297Q probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67,233,314 (GRCm39) missense probably damaging 1.00
IGL00808:Myh13 APN 11 67,225,830 (GRCm39) critical splice donor site probably null
IGL00822:Myh13 APN 11 67,252,154 (GRCm39) missense probably damaging 0.98
IGL00823:Myh13 APN 11 67,246,773 (GRCm39) missense probably benign 0.00
IGL00945:Myh13 APN 11 67,238,832 (GRCm39) missense probably null 1.00
IGL01414:Myh13 APN 11 67,233,298 (GRCm39) missense probably benign 0.02
IGL01482:Myh13 APN 11 67,242,894 (GRCm39) missense probably benign
IGL01523:Myh13 APN 11 67,238,769 (GRCm39) missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67,260,045 (GRCm39) unclassified probably benign
IGL01997:Myh13 APN 11 67,257,992 (GRCm39) missense probably benign 0.14
IGL02369:Myh13 APN 11 67,251,100 (GRCm39) unclassified probably benign
IGL02478:Myh13 APN 11 67,260,204 (GRCm39) missense probably benign
IGL02663:Myh13 APN 11 67,245,753 (GRCm39) nonsense probably null
IGL02851:Myh13 APN 11 67,239,742 (GRCm39) missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67,223,367 (GRCm39) missense probably damaging 1.00
IGL02929:Myh13 APN 11 67,257,991 (GRCm39) missense probably damaging 1.00
IGL02979:Myh13 APN 11 67,225,788 (GRCm39) missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67,235,679 (GRCm39) missense probably damaging 0.99
IGL03214:Myh13 APN 11 67,244,411 (GRCm39) missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67,241,068 (GRCm39) missense probably benign 0.39
IGL03231:Myh13 APN 11 67,242,817 (GRCm39) missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67,242,978 (GRCm39) missense probably damaging 1.00
3-1:Myh13 UTSW 11 67,242,777 (GRCm39) splice site probably benign
P0042:Myh13 UTSW 11 67,225,817 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0379:Myh13 UTSW 11 67,260,121 (GRCm39) unclassified probably benign
R0496:Myh13 UTSW 11 67,239,641 (GRCm39) missense probably damaging 1.00
R0584:Myh13 UTSW 11 67,251,200 (GRCm39) nonsense probably null
R0595:Myh13 UTSW 11 67,235,672 (GRCm39) missense probably benign 0.03
R0621:Myh13 UTSW 11 67,232,058 (GRCm39) missense probably damaging 0.98
R0834:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67,225,427 (GRCm39) missense probably damaging 1.00
R0964:Myh13 UTSW 11 67,235,828 (GRCm39) missense probably benign 0.02
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0974:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R1028:Myh13 UTSW 11 67,247,007 (GRCm39) missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67,245,576 (GRCm39) missense probably damaging 1.00
R1283:Myh13 UTSW 11 67,261,747 (GRCm39) missense probably damaging 1.00
R1288:Myh13 UTSW 11 67,244,544 (GRCm39) missense probably benign 0.00
R1386:Myh13 UTSW 11 67,261,776 (GRCm39) missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67,221,872 (GRCm39) missense probably damaging 0.97
R1503:Myh13 UTSW 11 67,244,500 (GRCm39) missense probably benign 0.43
R1574:Myh13 UTSW 11 67,253,407 (GRCm39) unclassified probably benign
R1673:Myh13 UTSW 11 67,242,945 (GRCm39) missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67,232,310 (GRCm39) missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67,225,402 (GRCm39) missense probably benign
R2029:Myh13 UTSW 11 67,252,115 (GRCm39) missense probably benign 0.03
R2030:Myh13 UTSW 11 67,241,064 (GRCm39) missense probably benign
R2247:Myh13 UTSW 11 67,225,384 (GRCm39) missense probably damaging 0.96
R2393:Myh13 UTSW 11 67,231,184 (GRCm39) missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67,255,748 (GRCm39) missense probably benign 0.12
R2884:Myh13 UTSW 11 67,228,469 (GRCm39) missense probably benign 0.27
R3696:Myh13 UTSW 11 67,235,870 (GRCm39) missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67,218,014 (GRCm39) missense probably benign 0.01
R3875:Myh13 UTSW 11 67,249,020 (GRCm39) missense probably benign 0.26
R3918:Myh13 UTSW 11 67,220,064 (GRCm39) missense probably benign 0.00
R4061:Myh13 UTSW 11 67,221,715 (GRCm39) missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67,255,636 (GRCm39) intron probably benign
R4183:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67,235,707 (GRCm39) splice site probably null
R4639:Myh13 UTSW 11 67,232,377 (GRCm39) missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67,255,564 (GRCm39) nonsense probably null
R4783:Myh13 UTSW 11 67,232,096 (GRCm39) missense probably damaging 1.00
R4877:Myh13 UTSW 11 67,228,477 (GRCm39) missense probably damaging 0.99
R5250:Myh13 UTSW 11 67,218,085 (GRCm39) nonsense probably null
R5278:Myh13 UTSW 11 67,225,390 (GRCm39) missense probably benign 0.00
R5371:Myh13 UTSW 11 67,235,616 (GRCm39) splice site probably null
R5479:Myh13 UTSW 11 67,239,648 (GRCm39) missense probably damaging 0.97
R5510:Myh13 UTSW 11 67,228,549 (GRCm39) missense probably benign 0.05
R5690:Myh13 UTSW 11 67,220,101 (GRCm39) missense probably damaging 1.00
R5797:Myh13 UTSW 11 67,225,828 (GRCm39) missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R5877:Myh13 UTSW 11 67,244,484 (GRCm39) missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67,255,556 (GRCm39) missense probably damaging 1.00
R6175:Myh13 UTSW 11 67,245,588 (GRCm39) missense probably benign 0.00
R6244:Myh13 UTSW 11 67,253,327 (GRCm39) missense probably benign 0.00
R6454:Myh13 UTSW 11 67,241,191 (GRCm39) missense probably benign 0.03
R6617:Myh13 UTSW 11 67,252,226 (GRCm39) missense probably benign 0.00
R6707:Myh13 UTSW 11 67,241,086 (GRCm39) missense probably damaging 1.00
R6747:Myh13 UTSW 11 67,241,245 (GRCm39) missense probably damaging 0.99
R6823:Myh13 UTSW 11 67,246,984 (GRCm39) missense probably benign
R6911:Myh13 UTSW 11 67,245,753 (GRCm39) nonsense probably null
R6997:Myh13 UTSW 11 67,217,980 (GRCm39) nonsense probably null
R7033:Myh13 UTSW 11 67,260,142 (GRCm39) missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67,245,566 (GRCm39) missense probably benign 0.08
R7232:Myh13 UTSW 11 67,239,672 (GRCm39) missense probably damaging 1.00
R7428:Myh13 UTSW 11 67,223,390 (GRCm39) missense probably damaging 1.00
R7448:Myh13 UTSW 11 67,255,286 (GRCm39) critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67,258,537 (GRCm39) missense
R7474:Myh13 UTSW 11 67,217,990 (GRCm39) missense possibly damaging 0.93
R7766:Myh13 UTSW 11 67,249,155 (GRCm39) missense probably benign 0.37
R7809:Myh13 UTSW 11 67,241,167 (GRCm39) missense probably benign 0.14
R7813:Myh13 UTSW 11 67,218,056 (GRCm39) missense probably benign 0.27
R7953:Myh13 UTSW 11 67,231,206 (GRCm39) missense probably damaging 1.00
R8085:Myh13 UTSW 11 67,225,613 (GRCm39) missense probably benign 0.00
R8397:Myh13 UTSW 11 67,241,113 (GRCm39) missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67,254,011 (GRCm39) critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67,255,351 (GRCm39) missense probably damaging 0.98
R8676:Myh13 UTSW 11 67,233,311 (GRCm39) missense probably damaging 1.00
R8681:Myh13 UTSW 11 67,242,960 (GRCm39) missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67,255,432 (GRCm39) missense probably benign 0.00
R9088:Myh13 UTSW 11 67,242,885 (GRCm39) missense probably damaging 1.00
R9151:Myh13 UTSW 11 67,252,149 (GRCm39) missense probably damaging 1.00
R9154:Myh13 UTSW 11 67,253,318 (GRCm39) missense probably benign
R9182:Myh13 UTSW 11 67,228,579 (GRCm39) missense probably damaging 1.00
R9332:Myh13 UTSW 11 67,254,109 (GRCm39) missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67,242,894 (GRCm39) missense probably benign
R9446:Myh13 UTSW 11 67,255,325 (GRCm39) missense probably benign 0.01
R9474:Myh13 UTSW 11 67,255,712 (GRCm39) missense
R9690:Myh13 UTSW 11 67,249,194 (GRCm39) missense probably damaging 1.00
R9778:Myh13 UTSW 11 67,249,016 (GRCm39) missense probably damaging 0.98
Z1176:Myh13 UTSW 11 67,220,121 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,255,417 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,241,278 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACCATTGTAATCCCCAGGCC -3'
(R):5'- CAAAGTCGGTCTATAGTCAGTCACC -3'

Sequencing Primer
(F):5'- TTGTAATCCCCAGGCCAAGAAC -3'
(R):5'- TAGTCAGTCACCAATTATCCAGG -3'
Posted On 2022-11-14