Incidental Mutation 'R9762:Efl1'
ID 733074
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R9762 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 82412596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 995 (D995A)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: D995A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: D995A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: D995A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: D995A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G T 19: 57,025,691 (GRCm39) R851S probably damaging Het
Acap2 C A 16: 30,929,763 (GRCm39) A407S probably damaging Het
Adam26a A T 8: 44,021,635 (GRCm39) S618R probably benign Het
Adamtsl5 T C 10: 80,180,896 (GRCm39) Y89C probably damaging Het
Aebp2 T A 6: 140,588,021 (GRCm39) S364T probably damaging Het
Ankfy1 A G 11: 72,621,401 (GRCm39) E229G probably benign Het
Arhgap27 G T 11: 103,251,511 (GRCm39) D72E probably benign Het
Arhgap33 T C 7: 30,230,950 (GRCm39) E191G probably null Het
Atp6v0a1 C T 11: 100,946,427 (GRCm39) H807Y possibly damaging Het
Ccdc113 A C 8: 96,272,605 (GRCm39) E237D probably benign Het
Cd200r2 T A 16: 44,729,420 (GRCm39) I25K probably benign Het
Cd300c2 A G 11: 114,887,775 (GRCm39) V209A probably damaging Het
Cdkn2d T A 9: 21,200,383 (GRCm39) E129D probably benign Het
Cfap251 A G 5: 123,460,533 (GRCm39) Y1165C probably damaging Het
Chd9 A T 8: 91,712,741 (GRCm39) N855Y unknown Het
Cntn3 A G 6: 102,254,196 (GRCm39) C249R probably damaging Het
Col12a1 T C 9: 79,527,266 (GRCm39) E2688G possibly damaging Het
Copb2 C T 9: 98,464,901 (GRCm39) T612I probably benign Het
Cplx1 A T 5: 108,673,378 (GRCm39) D29E possibly damaging Het
Cracd A G 5: 77,006,555 (GRCm39) K972R unknown Het
Cstf3 A T 2: 104,494,684 (GRCm39) R645* probably null Het
Ctdp1 A T 18: 80,492,550 (GRCm39) Y648* probably null Het
Daam1 T A 12: 71,990,855 (GRCm39) D156E unknown Het
Dbn1 G A 13: 55,622,824 (GRCm39) P599L probably damaging Het
Diaph1 C A 18: 37,987,589 (GRCm39) V1056F probably damaging Het
Dzip3 A T 16: 48,748,707 (GRCm39) D870E probably damaging Het
Efcab12 T C 6: 115,800,331 (GRCm39) T231A possibly damaging Het
Fam186a T C 15: 99,842,393 (GRCm39) T1284A possibly damaging Het
Fbxo33 T C 12: 59,251,708 (GRCm39) E269G probably benign Het
Foxj3 T A 4: 119,483,540 (GRCm39) M604K unknown Het
Gabra4 A G 5: 71,814,463 (GRCm39) S86P unknown Het
Gnas G A 2: 174,140,639 (GRCm39) W269* probably null Het
Gpc6 T G 14: 118,202,258 (GRCm39) N489K probably damaging Het
Gprin3 T C 6: 59,331,236 (GRCm39) K357R possibly damaging Het
Grip1 G T 10: 119,811,906 (GRCm39) A286S possibly damaging Het
Grm4 A T 17: 27,721,688 (GRCm39) V151E probably damaging Het
Gucy1b1 A T 3: 81,942,065 (GRCm39) S565T possibly damaging Het
Hace1 T C 10: 45,525,014 (GRCm39) V260A probably benign Het
Hepacam2 A G 6: 3,486,940 (GRCm39) I139T probably damaging Het
Hspa4l T C 3: 40,727,057 (GRCm39) I486T probably benign Het
Igkv8-19 T C 6: 70,317,866 (GRCm39) Y120C probably damaging Het
Iglv2 C T 16: 19,079,548 (GRCm39) probably benign Het
Igsf10 A T 3: 59,237,106 (GRCm39) L1025H probably damaging Het
Itpkb A G 1: 180,161,752 (GRCm39) N626S probably benign Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Klc3 C T 7: 19,132,023 (GRCm39) W118* probably null Het
Klhl25 C T 7: 75,516,741 (GRCm39) T549I probably damaging Het
Krtap6-2 T A 16: 89,216,763 (GRCm39) Y68F unknown Het
Mtcl1 T C 17: 66,673,347 (GRCm39) N1121D probably benign Het
Ncbp3 A G 11: 72,961,668 (GRCm39) K314R probably benign Het
Nop2 T C 6: 125,121,272 (GRCm39) W685R probably benign Het
Orc1 T A 4: 108,447,874 (GRCm39) D40E probably benign Het
Pappa2 G T 1: 158,684,948 (GRCm39) N730K probably damaging Het
Parpbp A G 10: 87,960,815 (GRCm39) S224P possibly damaging Het
Pdgfc A G 3: 80,944,792 (GRCm39) R17G probably benign Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Pik3r6 T A 11: 68,424,358 (GRCm39) L321* probably null Het
Pnp2 T C 14: 51,197,006 (GRCm39) W31R probably damaging Het
Prr12 T C 7: 44,696,954 (GRCm39) Y987C unknown Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss23 T C 7: 89,159,683 (GRCm39) I129V probably damaging Het
Rhno1 T C 6: 128,336,119 (GRCm39) T39A probably damaging Het
Rps2 A T 17: 24,940,810 (GRCm39) R279* probably null Het
Ski T C 4: 155,244,344 (GRCm39) K427R probably damaging Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc26a7 C T 4: 14,546,372 (GRCm39) G319D probably damaging Het
Slc7a6os A G 8: 106,937,523 (GRCm39) V8A probably damaging Het
Smim8 A C 4: 34,771,265 (GRCm39) I43S probably damaging Het
Sox5 T C 6: 143,819,842 (GRCm39) K400R probably damaging Het
Tab1 G A 15: 80,032,943 (GRCm39) V76M probably damaging Het
Taf2 A C 15: 54,894,440 (GRCm39) probably null Het
Taf5 G A 19: 47,059,434 (GRCm39) V193M probably damaging Het
Tm2d1 A T 4: 98,246,261 (GRCm39) S180R probably damaging Het
Ttc12 A G 9: 49,368,166 (GRCm39) F287S probably damaging Het
Ubqln4 G A 3: 88,473,185 (GRCm39) probably null Het
Ubr3 T C 2: 69,839,497 (GRCm39) V1537A probably benign Het
Ugt8a A G 3: 125,708,900 (GRCm39) L70P probably damaging Het
Vps26a A T 10: 62,316,433 (GRCm39) N51K probably benign Het
Xkr5 T A 8: 18,990,749 (GRCm39) T173S probably benign Het
Zfp354c A G 11: 50,706,239 (GRCm39) C279R probably damaging Het
Zfp65 T A 13: 67,856,478 (GRCm39) H267L probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTCACGTTGGAGATGAAAAC -3'
(R):5'- AGCCATGTATTTTCCATGCTGAG -3'

Sequencing Primer
(F):5'- CCAAGAGCAACAAGATGTCTG -3'
(R):5'- GAGAATTTAAGATACAGGTCTCTGGC -3'
Posted On 2022-11-14