Incidental Mutation 'R9762:Copb2'
ID 733084
Institutional Source Beutler Lab
Gene Symbol Copb2
Ensembl Gene ENSMUSG00000032458
Gene Name COPI coat complex subunit beta 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9762 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 98445784-98470428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98464901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 612 (T612I)
Ref Sequence ENSEMBL: ENSMUSP00000035033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035033]
AlphaFold O55029
Predicted Effect probably benign
Transcript: ENSMUST00000035033
AA Change: T612I

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035033
Gene: ENSMUSG00000032458
AA Change: T612I

DomainStartEndE-ValueType
WD40 4 43 1.18e-1 SMART
WD40 46 85 3.9e-2 SMART
WD40 88 127 4.05e-9 SMART
WD40 131 171 1.51e-8 SMART
WD40 174 215 7.97e-8 SMART
WD40 218 257 5.9e-11 SMART
Pfam:Coatomer_WDAD 319 763 3.2e-176 PFAM
low complexity region 876 892 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi coatomer complex (see MIM 601924) constitutes the coat of nonclathrin-coated vesicles and is essential for Golgi budding and vesicular trafficking. It consists of 7 protein subunits, including COPB2.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G T 19: 57,025,691 (GRCm39) R851S probably damaging Het
Acap2 C A 16: 30,929,763 (GRCm39) A407S probably damaging Het
Adam26a A T 8: 44,021,635 (GRCm39) S618R probably benign Het
Adamtsl5 T C 10: 80,180,896 (GRCm39) Y89C probably damaging Het
Aebp2 T A 6: 140,588,021 (GRCm39) S364T probably damaging Het
Ankfy1 A G 11: 72,621,401 (GRCm39) E229G probably benign Het
Arhgap27 G T 11: 103,251,511 (GRCm39) D72E probably benign Het
Arhgap33 T C 7: 30,230,950 (GRCm39) E191G probably null Het
Atp6v0a1 C T 11: 100,946,427 (GRCm39) H807Y possibly damaging Het
Ccdc113 A C 8: 96,272,605 (GRCm39) E237D probably benign Het
Cd200r2 T A 16: 44,729,420 (GRCm39) I25K probably benign Het
Cd300c2 A G 11: 114,887,775 (GRCm39) V209A probably damaging Het
Cdkn2d T A 9: 21,200,383 (GRCm39) E129D probably benign Het
Cfap251 A G 5: 123,460,533 (GRCm39) Y1165C probably damaging Het
Chd9 A T 8: 91,712,741 (GRCm39) N855Y unknown Het
Cntn3 A G 6: 102,254,196 (GRCm39) C249R probably damaging Het
Col12a1 T C 9: 79,527,266 (GRCm39) E2688G possibly damaging Het
Cplx1 A T 5: 108,673,378 (GRCm39) D29E possibly damaging Het
Cracd A G 5: 77,006,555 (GRCm39) K972R unknown Het
Cstf3 A T 2: 104,494,684 (GRCm39) R645* probably null Het
Ctdp1 A T 18: 80,492,550 (GRCm39) Y648* probably null Het
Daam1 T A 12: 71,990,855 (GRCm39) D156E unknown Het
Dbn1 G A 13: 55,622,824 (GRCm39) P599L probably damaging Het
Diaph1 C A 18: 37,987,589 (GRCm39) V1056F probably damaging Het
Dzip3 A T 16: 48,748,707 (GRCm39) D870E probably damaging Het
Efcab12 T C 6: 115,800,331 (GRCm39) T231A possibly damaging Het
Efl1 A C 7: 82,412,596 (GRCm39) D995A probably benign Het
Fam186a T C 15: 99,842,393 (GRCm39) T1284A possibly damaging Het
Fbxo33 T C 12: 59,251,708 (GRCm39) E269G probably benign Het
Foxj3 T A 4: 119,483,540 (GRCm39) M604K unknown Het
Gabra4 A G 5: 71,814,463 (GRCm39) S86P unknown Het
Gnas G A 2: 174,140,639 (GRCm39) W269* probably null Het
Gpc6 T G 14: 118,202,258 (GRCm39) N489K probably damaging Het
Gprin3 T C 6: 59,331,236 (GRCm39) K357R possibly damaging Het
Grip1 G T 10: 119,811,906 (GRCm39) A286S possibly damaging Het
Grm4 A T 17: 27,721,688 (GRCm39) V151E probably damaging Het
Gucy1b1 A T 3: 81,942,065 (GRCm39) S565T possibly damaging Het
Hace1 T C 10: 45,525,014 (GRCm39) V260A probably benign Het
Hepacam2 A G 6: 3,486,940 (GRCm39) I139T probably damaging Het
Hspa4l T C 3: 40,727,057 (GRCm39) I486T probably benign Het
Igkv8-19 T C 6: 70,317,866 (GRCm39) Y120C probably damaging Het
Iglv2 C T 16: 19,079,548 (GRCm39) probably benign Het
Igsf10 A T 3: 59,237,106 (GRCm39) L1025H probably damaging Het
Itpkb A G 1: 180,161,752 (GRCm39) N626S probably benign Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Klc3 C T 7: 19,132,023 (GRCm39) W118* probably null Het
Klhl25 C T 7: 75,516,741 (GRCm39) T549I probably damaging Het
Krtap6-2 T A 16: 89,216,763 (GRCm39) Y68F unknown Het
Mtcl1 T C 17: 66,673,347 (GRCm39) N1121D probably benign Het
Ncbp3 A G 11: 72,961,668 (GRCm39) K314R probably benign Het
Nop2 T C 6: 125,121,272 (GRCm39) W685R probably benign Het
Orc1 T A 4: 108,447,874 (GRCm39) D40E probably benign Het
Pappa2 G T 1: 158,684,948 (GRCm39) N730K probably damaging Het
Parpbp A G 10: 87,960,815 (GRCm39) S224P possibly damaging Het
Pdgfc A G 3: 80,944,792 (GRCm39) R17G probably benign Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Pik3r6 T A 11: 68,424,358 (GRCm39) L321* probably null Het
Pnp2 T C 14: 51,197,006 (GRCm39) W31R probably damaging Het
Prr12 T C 7: 44,696,954 (GRCm39) Y987C unknown Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss23 T C 7: 89,159,683 (GRCm39) I129V probably damaging Het
Rhno1 T C 6: 128,336,119 (GRCm39) T39A probably damaging Het
Rps2 A T 17: 24,940,810 (GRCm39) R279* probably null Het
Ski T C 4: 155,244,344 (GRCm39) K427R probably damaging Het
Slc23a3 ATT ATTT 1: 75,109,925 (GRCm39) probably null Het
Slc26a7 C T 4: 14,546,372 (GRCm39) G319D probably damaging Het
Slc7a6os A G 8: 106,937,523 (GRCm39) V8A probably damaging Het
Smim8 A C 4: 34,771,265 (GRCm39) I43S probably damaging Het
Sox5 T C 6: 143,819,842 (GRCm39) K400R probably damaging Het
Tab1 G A 15: 80,032,943 (GRCm39) V76M probably damaging Het
Taf2 A C 15: 54,894,440 (GRCm39) probably null Het
Taf5 G A 19: 47,059,434 (GRCm39) V193M probably damaging Het
Tm2d1 A T 4: 98,246,261 (GRCm39) S180R probably damaging Het
Ttc12 A G 9: 49,368,166 (GRCm39) F287S probably damaging Het
Ubqln4 G A 3: 88,473,185 (GRCm39) probably null Het
Ubr3 T C 2: 69,839,497 (GRCm39) V1537A probably benign Het
Ugt8a A G 3: 125,708,900 (GRCm39) L70P probably damaging Het
Vps26a A T 10: 62,316,433 (GRCm39) N51K probably benign Het
Xkr5 T A 8: 18,990,749 (GRCm39) T173S probably benign Het
Zfp354c A G 11: 50,706,239 (GRCm39) C279R probably damaging Het
Zfp65 T A 13: 67,856,478 (GRCm39) H267L probably damaging Het
Other mutations in Copb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Copb2 APN 9 98,450,130 (GRCm39) missense probably benign 0.00
IGL00496:Copb2 APN 9 98,452,371 (GRCm39) missense probably benign 0.00
IGL00518:Copb2 APN 9 98,464,947 (GRCm39) missense possibly damaging 0.95
IGL00642:Copb2 APN 9 98,461,086 (GRCm39) missense probably damaging 1.00
IGL00793:Copb2 APN 9 98,467,057 (GRCm39) missense probably benign
IGL00806:Copb2 APN 9 98,452,717 (GRCm39) missense probably damaging 0.97
IGL01599:Copb2 APN 9 98,463,203 (GRCm39) missense probably damaging 0.98
IGL01906:Copb2 APN 9 98,462,383 (GRCm39) missense probably benign 0.10
IGL02129:Copb2 APN 9 98,467,976 (GRCm39) unclassified probably benign
IGL02138:Copb2 APN 9 98,469,605 (GRCm39) missense probably benign
IGL03033:Copb2 APN 9 98,452,426 (GRCm39) missense probably benign 0.10
R0646:Copb2 UTSW 9 98,445,528 (GRCm39) unclassified probably benign
R0709:Copb2 UTSW 9 98,445,220 (GRCm39) unclassified probably benign
R1631:Copb2 UTSW 9 98,462,213 (GRCm39) missense probably benign 0.00
R2510:Copb2 UTSW 9 98,453,701 (GRCm39) splice site probably benign
R4862:Copb2 UTSW 9 98,463,320 (GRCm39) missense probably damaging 1.00
R5322:Copb2 UTSW 9 98,468,029 (GRCm39) missense probably benign 0.03
R5593:Copb2 UTSW 9 98,469,091 (GRCm39) critical splice acceptor site probably null
R5745:Copb2 UTSW 9 98,456,164 (GRCm39) missense probably damaging 0.99
R5859:Copb2 UTSW 9 98,450,161 (GRCm39) missense probably benign 0.17
R5990:Copb2 UTSW 9 98,452,378 (GRCm39) missense probably damaging 1.00
R7109:Copb2 UTSW 9 98,463,333 (GRCm39) critical splice donor site probably null
R7124:Copb2 UTSW 9 98,459,106 (GRCm39) missense probably damaging 0.98
R7211:Copb2 UTSW 9 98,456,198 (GRCm39) missense probably damaging 1.00
R7829:Copb2 UTSW 9 98,470,147 (GRCm39) missense probably damaging 0.99
R7960:Copb2 UTSW 9 98,462,407 (GRCm39) missense possibly damaging 0.65
R8311:Copb2 UTSW 9 98,450,072 (GRCm39) missense possibly damaging 0.78
R8537:Copb2 UTSW 9 98,469,672 (GRCm39) missense probably null 0.00
R8982:Copb2 UTSW 9 98,456,164 (GRCm39) missense probably damaging 0.99
R9539:Copb2 UTSW 9 98,467,983 (GRCm39) critical splice acceptor site probably null
R9800:Copb2 UTSW 9 98,461,081 (GRCm39) missense probably damaging 0.99
Z1176:Copb2 UTSW 9 98,468,199 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGTTTCTCTTTCTCTTACAGGACAATG -3'
(R):5'- AGGTTCCTACGCCTAAAGAAGC -3'

Sequencing Primer
(F):5'- ACAGGACAATGTATCTTCTGGGC -3'
(R):5'- TGCTGCCAACCTGATATGG -3'
Posted On 2022-11-14