Incidental Mutation 'R9764:Itpkc'
ID 733143
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Name inositol 1,4,5-trisphosphate 3-kinase C
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R9764 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 27207172-27228661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27227797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 231 (T231A)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850]
AlphaFold Q7TS72
Predicted Effect probably benign
Transcript: ENSMUST00000003850
AA Change: T231A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: T231A

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029F12Rik T C 13: 97,030,230 T93A unknown Het
Adgrg6 T A 10: 14,426,771 H938L probably benign Het
Aff1 A G 5: 103,849,499 Y1153C probably damaging Het
Akr1c20 T A 13: 4,514,389 I42L probably benign Het
Atad2b T A 12: 5,032,064 N1324K probably benign Het
Aurka T A 2: 172,359,840 I270F probably damaging Het
Camk2g A T 14: 20,765,430 D189E probably damaging Het
Cc2d2b A G 19: 40,815,855 D942G unknown Het
Ccnd1 A C 7: 144,938,033 S90A probably benign Het
Cfap77 G T 2: 28,962,729 T177K probably damaging Het
Chd9 A G 8: 90,994,592 N1003D unknown Het
Chga C G 12: 102,559,354 Q85E possibly damaging Het
Cnot1 T C 8: 95,769,581 S322G probably benign Het
Cyp8b1 C A 9: 121,915,228 S346I probably benign Het
Cysltr2 T A 14: 73,029,466 H268L probably damaging Het
Dnah11 T C 12: 117,920,969 T3783A probably benign Het
Dock3 C T 9: 107,082,514 V109I probably benign Het
Dscc1 A G 15: 55,090,278 C50R probably benign Het
Dtx3l T A 16: 35,932,907 D443V probably damaging Het
Ephb6 A G 6: 41,615,977 H383R probably benign Het
Fdft1 A G 14: 63,163,420 I88T probably damaging Het
Fmo3 C A 1: 162,966,955 W182L probably benign Het
Folh1 T A 7: 86,756,950 Q305L probably benign Het
Gale C T 4: 135,965,664 Q73* probably null Het
Gm9195 T C 14: 72,462,445 M1154V unknown Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gtsf1l T C 2: 163,087,132 T144A probably benign Het
Kng2 C A 16: 23,003,987 C205F probably damaging Het
Ldlrap1 T G 4: 134,749,350 N244T probably benign Het
Lingo2 A G 4: 35,709,750 F77L possibly damaging Het
Lpcat2b A T 5: 107,433,572 T256S possibly damaging Het
Lrit2 A G 14: 37,068,979 D205G probably damaging Het
Lrrc34 T C 3: 30,643,318 D88G probably damaging Het
Macf1 T C 4: 123,472,343 E2875G probably benign Het
Med13 G T 11: 86,286,519 Q1584K possibly damaging Het
Naip5 C G 13: 100,230,761 A276P probably damaging Het
Ndufv2 A G 17: 66,087,508 Y121H probably damaging Het
Olfr1275 T A 2: 111,231,176 I206F probably damaging Het
Peg12 T C 7: 62,463,549 T267A unknown Het
Pkig A G 2: 163,725,455 probably null Het
Prkch C G 12: 73,700,304 T319S probably benign Het
Rhobtb1 T C 10: 69,279,372 S534P probably damaging Het
Riok2 A G 17: 17,387,552 N454S probably benign Het
Ryr2 T A 13: 11,687,049 K2907N possibly damaging Het
Sdc3 C T 4: 130,818,737 P136S unknown Het
Slc37a3 G A 6: 39,345,910 L371F probably damaging Het
Slc3a1 A T 17: 85,063,991 H657L probably damaging Het
Slc7a13 T A 4: 19,819,033 Y78N probably benign Het
Slfn8 G T 11: 83,017,012 A235E probably damaging Het
Snap91 T A 9: 86,825,041 D232V possibly damaging Het
Stap2 C A 17: 56,002,914 S79I probably damaging Het
Stra6l T C 4: 45,884,602 V544A probably damaging Het
Syn2 T C 6: 115,274,258 probably null Het
Tctn1 G A 5: 122,250,464 P284S possibly damaging Het
Terb2 G A 2: 122,187,994 M77I probably benign Het
Trim80 G T 11: 115,447,931 R529L possibly damaging Het
Washc2 T C 6: 116,209,087 L86P possibly damaging Het
Zfp74 A T 7: 29,932,420 F133Y probably benign Het
Zfp987 T A 4: 146,124,182 N61K probably benign Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
R9216:Itpkc UTSW 7 27228004 missense probably benign 0.19
R9634:Itpkc UTSW 7 27214455 missense probably benign 0.29
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGTCACCAACTCTCCAGGC -3'
(R):5'- GGACAGATCCGATATGTGGC -3'

Sequencing Primer
(F):5'- CTCCAGGCTCTGATAAATCTAATGG -3'
(R):5'- CAGATCCGATATGTGGCAGACTCTG -3'
Posted On 2022-11-14