Mutagenetix > Incidental Mutation

Incidental Mutation 'R9765:Cdh19'

733182

Institutional Source

Beutler Lab

Gene Symbol

Cdh19

Ensembl Gene

ENSMUSG00000047216

Gene Name

cadherin 19, type 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9765 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110888326-110977584 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 110895381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094626]

AlphaFold

E9Q3A7

Predicted Effect

probably null
Transcript: ENSMUST00000094626

SMART Domains

Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
CA	64	144	2.44e-14	SMART
CA	168	252	3.21e-23	SMART
CA	276	367	6.2e-7	SMART
CA	390	466	2.69e-16	SMART
CA	489	576	6.68e-3	SMART
transmembrane domain	594	616	N/A	INTRINSIC
Pfam:Cadherin_C	619	764	1.7e-50	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,454,829	V25I	probably benign	Het
Actr1b	T	A	1: 36,702,596	H65L	probably benign	Het
Adgrf5	G	A	17: 43,437,600	G440E	probably damaging	Het
Ash1l	T	A	3: 89,023,193	D1992E	probably damaging	Het
Cacng4	A	G	11: 107,741,983	F81S	probably damaging	Het
Cdca8	A	G	4: 124,920,329	I223T	probably benign	Het
Ces2f	A	G	8: 104,950,046	D124G	probably damaging	Het
Cks1brt	A	G	8: 85,171,605	Y29C	probably damaging	Het
Cntnap4	T	C	8: 112,757,478	S388P	probably benign	Het
Cntnap4	T	C	8: 112,841,864	I844T	probably damaging	Het
Col4a3	G	A	1: 82,668,957	W396*	probably null	Het
Cul9	A	T	17: 46,539,298	S449T	probably benign	Het
Cux2	G	A	5: 121,869,132	P822L	probably benign	Het
Cyp3a13	G	C	5: 137,911,621	P147A	probably damaging	Het
Dennd2a	C	T	6: 39,496,973		probably null	Het
Dgkg	T	C	16: 22,479,407	M743V	possibly damaging	Het
Dhx35	C	T	2: 158,829,581	R311W	probably benign	Het
Dnase1l2	A	T	17: 24,441,075	V273E	probably damaging	Het
Dock8	T	G	19: 25,169,468	I1437S	possibly damaging	Het
Dpy19l3	T	C	7: 35,708,631	D450G	probably benign	Het
Dsg4	G	A	18: 20,471,277	V934I	probably benign	Het
Eef2	T	A	10: 81,179,176	F236L	possibly damaging	Het
Eml4	A	G	17: 83,440,069	I247V	probably damaging	Het
Evi5	A	C	5: 107,799,254	C451G	probably benign	Het
Fam124a	T	G	14: 62,587,434	W126G	probably damaging	Het
Fbxw21	A	G	9: 109,146,557	I257T	possibly damaging	Het
Fn3krp	A	G	11: 121,421,478	K6E	probably benign	Het
Gcn1l1	G	A	5: 115,597,072	W1149*	probably null	Het
Glud1	C	T	14: 34,338,838	R453*	probably null	Het
Gtf2f1	G	A	17: 57,011,125		probably benign	Het
Gtpbp4	T	A	13: 8,974,958	D532V	probably benign	Het
Ifnar2	G	A	16: 91,388,087	R122H	possibly damaging	Het
Ipo11	A	G	13: 106,925,048	W35R	probably damaging	Het
Iqgap3	G	A	3: 88,110,054	R1115Q	possibly damaging	Het
Kifc5b	A	G	17: 26,923,265	E239G	probably damaging	Het
Map3k7	A	T	4: 32,019,519	E553D	probably damaging	Het
Mdh1	G	T	11: 21,562,926	S146*	probably null	Het
Muc16	C	A	9: 18,637,198	W5933L	probably benign	Het
Myo16	C	A	8: 10,570,401	P1651T	probably damaging	Het
Naip5	C	G	13: 100,230,761	A276P	probably damaging	Het
Noxo1	G	T	17: 24,696,412		probably benign	Het
Olfr1299	T	A	2: 111,664,885	Y220N	probably benign	Het
Pcdhgb6	A	T	18: 37,743,001	N254I	possibly damaging	Het
Peli3	A	T	19: 4,941,822	C30*	probably null	Het
Plb1	T	A	5: 32,355,387	M1363K	probably damaging	Het
Ppp4r4	G	T	12: 103,584,087	E257*	probably null	Het
Rbm20	T	G	19: 53,851,629	S1016R	probably benign	Het
Rcn1	A	T	2: 105,394,681	L143Q	possibly damaging	Het
Retreg1	G	A	15: 25,940,899	G3D	unknown	Het
Rrm2	A	G	12: 24,708,957	N65D	probably benign	Het
Samhd1	G	T	2: 157,123,299	H199N	probably damaging	Het
Slain2	T	A	5: 72,957,626	L400*	probably null	Het
Slc26a7	A	T	4: 14,522,862	M486K	probably benign	Het
Slc30a4	A	T	2: 122,694,536	Y133N	probably damaging	Het
Spef2	A	T	15: 9,601,859	F1439Y	unknown	Het
Srpr	T	C	9: 35,211,374	V29A	possibly damaging	Het
St3gal1	T	C	15: 67,109,650	T226A	possibly damaging	Het
Tas2r136	T	A	6: 132,777,850	I105F	probably benign	Het
Tmem208	A	G	8: 105,334,874	*177W	probably null	Het
Ttc30b	A	T	2: 75,938,123	Y95*	probably null	Het
Utrn	T	A	10: 12,735,177	N478I	probably damaging	Het
Zbtb37	T	C	1: 161,031,862	Y291C	probably damaging	Het
Zc3h3	T	G	15: 75,837,610	H470P	probably benign	Het
Zfp40	A	T	17: 23,176,889	Y241*	probably null	Het
Zfp457	T	C	13: 67,292,810	N567S	probably benign	Het
Zfp458	C	T	13: 67,260,153	V33M	probably damaging	Het
Zfp953	A	T	13: 67,343,414	I158N	possibly damaging	Het

Other mutations in Cdh19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Cdh19	APN	1	110949252	missense	probably damaging	1.00
IGL00863:Cdh19	APN	1	110949144	missense	probably damaging	1.00
IGL01537:Cdh19	APN	1	110919611	missense	possibly damaging	0.73
IGL02108:Cdh19	APN	1	110889731	missense	probably benign	0.31
IGL02125:Cdh19	APN	1	110929884	missense	possibly damaging	0.94
IGL02234:Cdh19	APN	1	110932226	missense	probably damaging	1.00
IGL02251:Cdh19	APN	1	110954652	missense	probably benign	0.00
IGL02275:Cdh19	APN	1	110925886	missense	probably benign	0.21
IGL03203:Cdh19	APN	1	110890098	missense	possibly damaging	0.82
R0539:Cdh19	UTSW	1	110925162	missense	possibly damaging	0.81
R0594:Cdh19	UTSW	1	110925867	missense	probably benign	0.40
R0612:Cdh19	UTSW	1	110893170	splice site	probably benign
R1028:Cdh19	UTSW	1	110954584	missense	probably benign	0.03
R1627:Cdh19	UTSW	1	110919645	missense	probably benign	0.16
R1728:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1729:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1730:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1739:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1762:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1783:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1785:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1974:Cdh19	UTSW	1	110890159	missense	possibly damaging	0.50
R2119:Cdh19	UTSW	1	110919590	missense	probably benign	0.00
R3026:Cdh19	UTSW	1	110954688	missense	probably benign	0.03
R3037:Cdh19	UTSW	1	110954607	missense	probably damaging	1.00
R3612:Cdh19	UTSW	1	110893296	missense	probably damaging	1.00
R4254:Cdh19	UTSW	1	110925030	missense	probably damaging	1.00
R4368:Cdh19	UTSW	1	110889712	nonsense	probably null
R4624:Cdh19	UTSW	1	110932251	missense	probably benign	0.25
R4648:Cdh19	UTSW	1	110925177	missense	probably benign	0.04
R4720:Cdh19	UTSW	1	110895381	critical splice donor site	probably null
R4766:Cdh19	UTSW	1	110893260	missense	probably benign	0.39
R4937:Cdh19	UTSW	1	110889964	missense	probably damaging	1.00
R4968:Cdh19	UTSW	1	110925228	missense	probably benign	0.08
R4970:Cdh19	UTSW	1	110954624	missense	possibly damaging	0.68
R5095:Cdh19	UTSW	1	110954661	missense	probably benign
R5112:Cdh19	UTSW	1	110954624	missense	possibly damaging	0.68
R5586:Cdh19	UTSW	1	110929857	missense	probably damaging	1.00
R6431:Cdh19	UTSW	1	110925057	missense	probably benign	0.00
R6595:Cdh19	UTSW	1	110925787	missense	probably benign	0.15
R6997:Cdh19	UTSW	1	110954866	start gained	probably benign
R7240:Cdh19	UTSW	1	110893407	missense	probably benign
R8252:Cdh19	UTSW	1	110889885	missense	probably benign	0.00
R8299:Cdh19	UTSW	1	110919548	missense	probably benign	0.01
R8416:Cdh19	UTSW	1	110925880	missense	probably benign	0.13
R8766:Cdh19	UTSW	1	110890114	missense	probably benign	0.33
R9090:Cdh19	UTSW	1	110949217	missense	probably damaging	1.00
R9177:Cdh19	UTSW	1	110949381	missense	probably damaging	1.00
R9266:Cdh19	UTSW	1	110890041	missense	probably damaging	1.00
R9268:Cdh19	UTSW	1	110949381	missense	probably damaging	1.00
R9271:Cdh19	UTSW	1	110949217	missense	probably damaging	1.00
R9533:Cdh19	UTSW	1	110889859	missense	probably damaging	1.00
R9560:Cdh19	UTSW	1	110893274	missense	possibly damaging	0.61
Z1176:Cdh19	UTSW	1	110893306	missense	probably benign	0.00
Z1176:Cdh19	UTSW	1	110895387	missense	probably damaging	1.00
Z1176:Cdh19	UTSW	1	110932214	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGAACCAGTGTCCTTCAAGTTC -3'
(R):5'- GAGGTCTGCAATATCCTTAATGATG -3'

Sequencing Primer
(F):5'- CAGTGTCCTTCAAGTTCATTTTGAG -3'
(R):5'- GTGCAATTGATAGAGATGAGTC -3'

Posted On

2022-11-14