Incidental Mutation 'R9765:Dhx35'
ID 733189
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene Name DEAH-box helicase 35
Synonyms 1200009D07Rik, Ddx35
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 158636727-158700134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 158671501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 311 (R311W)
Ref Sequence ENSEMBL: ENSMUSP00000029186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
AlphaFold A2ACQ1
Predicted Effect probably benign
Transcript: ENSMUST00000029186
AA Change: R311W

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: R311W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109478
AA Change: R311W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: R311W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156893
AA Change: R212W
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655
AA Change: R212W

DomainStartEndE-ValueType
PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,404,829 (GRCm39) V25I probably benign Het
Actr1b T A 1: 36,741,677 (GRCm39) H65L probably benign Het
Adgrf5 G A 17: 43,748,491 (GRCm39) G440E probably damaging Het
Ash1l T A 3: 88,930,500 (GRCm39) D1992E probably damaging Het
Cacng4 A G 11: 107,632,809 (GRCm39) F81S probably damaging Het
Cdca8 A G 4: 124,814,122 (GRCm39) I223T probably benign Het
Cdh19 A G 1: 110,823,111 (GRCm39) probably null Het
Ces2f A G 8: 105,676,678 (GRCm39) D124G probably damaging Het
Cks1brt A G 8: 85,898,234 (GRCm39) Y29C probably damaging Het
Cntnap4 T C 8: 113,484,110 (GRCm39) S388P probably benign Het
Cntnap4 T C 8: 113,568,496 (GRCm39) I844T probably damaging Het
Col4a3 G A 1: 82,646,678 (GRCm39) W396* probably null Het
Cul9 A T 17: 46,850,224 (GRCm39) S449T probably benign Het
Cux2 G A 5: 122,007,195 (GRCm39) P822L probably benign Het
Cyp3a13 G C 5: 137,909,883 (GRCm39) P147A probably damaging Het
Dennd2a C T 6: 39,473,907 (GRCm39) probably null Het
Dgkg T C 16: 22,298,157 (GRCm39) M743V possibly damaging Het
Dnase1l2 A T 17: 24,660,049 (GRCm39) V273E probably damaging Het
Dock8 T G 19: 25,146,832 (GRCm39) I1437S possibly damaging Het
Dpy19l3 T C 7: 35,408,056 (GRCm39) D450G probably benign Het
Dsg4 G A 18: 20,604,334 (GRCm39) V934I probably benign Het
Eef2 T A 10: 81,015,010 (GRCm39) F236L possibly damaging Het
Eml4 A G 17: 83,747,498 (GRCm39) I247V probably damaging Het
Evi5 A C 5: 107,947,120 (GRCm39) C451G probably benign Het
Fam124a T G 14: 62,824,883 (GRCm39) W126G probably damaging Het
Fbxw21 A G 9: 108,975,625 (GRCm39) I257T possibly damaging Het
Fn3krp A G 11: 121,312,304 (GRCm39) K6E probably benign Het
Gcn1 G A 5: 115,735,131 (GRCm39) W1149* probably null Het
Glud1 C T 14: 34,060,795 (GRCm39) R453* probably null Het
Gtf2f1 G A 17: 57,318,125 (GRCm39) probably benign Het
Gtpbp4 T A 13: 9,024,994 (GRCm39) D532V probably benign Het
Ifnar2 G A 16: 91,184,975 (GRCm39) R122H possibly damaging Het
Ift70b A T 2: 75,768,467 (GRCm39) Y95* probably null Het
Ipo11 A G 13: 107,061,556 (GRCm39) W35R probably damaging Het
Iqgap3 G A 3: 88,017,361 (GRCm39) R1115Q possibly damaging Het
Kifc5b A G 17: 27,142,239 (GRCm39) E239G probably damaging Het
Map3k7 A T 4: 32,019,519 (GRCm39) E553D probably damaging Het
Mdh1 G T 11: 21,512,926 (GRCm39) S146* probably null Het
Muc16 C A 9: 18,548,494 (GRCm39) W5933L probably benign Het
Myo16 C A 8: 10,620,401 (GRCm39) P1651T probably damaging Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Noxo1 G T 17: 24,915,386 (GRCm39) probably benign Het
Or4k49 T A 2: 111,495,230 (GRCm39) Y220N probably benign Het
Pcdhgb6 A T 18: 37,876,054 (GRCm39) N254I possibly damaging Het
Peli3 A T 19: 4,991,850 (GRCm39) C30* probably null Het
Plb1 T A 5: 32,512,731 (GRCm39) M1363K probably damaging Het
Ppp4r4 G T 12: 103,550,346 (GRCm39) E257* probably null Het
Rbm20 T G 19: 53,840,060 (GRCm39) S1016R probably benign Het
Rcn1 A T 2: 105,225,026 (GRCm39) L143Q possibly damaging Het
Retreg1 G A 15: 25,940,985 (GRCm39) G3D unknown Het
Rrm2 A G 12: 24,758,956 (GRCm39) N65D probably benign Het
Samhd1 G T 2: 156,965,219 (GRCm39) H199N probably damaging Het
Slain2 T A 5: 73,114,969 (GRCm39) L400* probably null Het
Slc26a7 A T 4: 14,522,862 (GRCm39) M486K probably benign Het
Slc30a4 A T 2: 122,536,456 (GRCm39) Y133N probably damaging Het
Spef2 A T 15: 9,601,945 (GRCm39) F1439Y unknown Het
Srpra T C 9: 35,122,670 (GRCm39) V29A possibly damaging Het
St3gal1 T C 15: 66,981,499 (GRCm39) T226A possibly damaging Het
Tas2r136 T A 6: 132,754,813 (GRCm39) I105F probably benign Het
Tmem208 A G 8: 106,061,506 (GRCm39) *177W probably null Het
Utrn T A 10: 12,610,921 (GRCm39) N478I probably damaging Het
Zbtb37 T C 1: 160,859,432 (GRCm39) Y291C probably damaging Het
Zc3h3 T G 15: 75,709,459 (GRCm39) H470P probably benign Het
Zfp40 A T 17: 23,395,863 (GRCm39) Y241* probably null Het
Zfp457 T C 13: 67,440,874 (GRCm39) N567S probably benign Het
Zfp458 C T 13: 67,408,217 (GRCm39) V33M probably damaging Het
Zfp953 A T 13: 67,491,478 (GRCm39) I158N possibly damaging Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158,669,836 (GRCm39) missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158,673,784 (GRCm39) missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158,643,370 (GRCm39) missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158,662,336 (GRCm39) missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158,699,052 (GRCm39) utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158,682,540 (GRCm39) missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158,671,543 (GRCm39) missense probably benign
R0609:Dhx35 UTSW 2 158,659,335 (GRCm39) missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158,686,103 (GRCm39) missense probably benign
R0884:Dhx35 UTSW 2 158,673,631 (GRCm39) missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158,648,357 (GRCm39) missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158,684,227 (GRCm39) missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158,673,781 (GRCm39) missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158,684,276 (GRCm39) missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158,684,272 (GRCm39) nonsense probably null
R4421:Dhx35 UTSW 2 158,648,321 (GRCm39) missense probably damaging 1.00
R4565:Dhx35 UTSW 2 158,691,455 (GRCm39) missense probably benign 0.01
R5517:Dhx35 UTSW 2 158,676,832 (GRCm39) missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158,673,705 (GRCm39) missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158,684,789 (GRCm39) missense probably benign 0.29
R6054:Dhx35 UTSW 2 158,660,219 (GRCm39) missense probably benign 0.00
R6405:Dhx35 UTSW 2 158,636,839 (GRCm39) missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158,673,607 (GRCm39) missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158,673,630 (GRCm39) missense probably damaging 0.97
R8700:Dhx35 UTSW 2 158,682,552 (GRCm39) missense possibly damaging 0.61
R8894:Dhx35 UTSW 2 158,676,795 (GRCm39) missense possibly damaging 0.77
R8906:Dhx35 UTSW 2 158,648,918 (GRCm39) missense possibly damaging 0.90
R8960:Dhx35 UTSW 2 158,657,393 (GRCm39) missense possibly damaging 0.83
R9349:Dhx35 UTSW 2 158,671,444 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTTCTGAAGGTGACCACAG -3'
(R):5'- GTGTCTACACTTACACACGAGTGC -3'

Sequencing Primer
(F):5'- GCTAAAGCCCCGTTCCAG -3'
(R):5'- CACACGAGTGCTCTCACAC -3'
Posted On 2022-11-14