Incidental Mutation 'R9765:Dpy19l3'
ID 733203
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Name dpy-19 like C-mannosyltransferase 3
Synonyms 9330164H19Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 35384925-35453879 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35408056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 450 (D450G)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
AlphaFold Q71B07
Predicted Effect probably benign
Transcript: ENSMUST00000051377
AA Change: D450G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: D450G

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,404,829 (GRCm39) V25I probably benign Het
Actr1b T A 1: 36,741,677 (GRCm39) H65L probably benign Het
Adgrf5 G A 17: 43,748,491 (GRCm39) G440E probably damaging Het
Ash1l T A 3: 88,930,500 (GRCm39) D1992E probably damaging Het
Cacng4 A G 11: 107,632,809 (GRCm39) F81S probably damaging Het
Cdca8 A G 4: 124,814,122 (GRCm39) I223T probably benign Het
Cdh19 A G 1: 110,823,111 (GRCm39) probably null Het
Ces2f A G 8: 105,676,678 (GRCm39) D124G probably damaging Het
Cks1brt A G 8: 85,898,234 (GRCm39) Y29C probably damaging Het
Cntnap4 T C 8: 113,484,110 (GRCm39) S388P probably benign Het
Cntnap4 T C 8: 113,568,496 (GRCm39) I844T probably damaging Het
Col4a3 G A 1: 82,646,678 (GRCm39) W396* probably null Het
Cul9 A T 17: 46,850,224 (GRCm39) S449T probably benign Het
Cux2 G A 5: 122,007,195 (GRCm39) P822L probably benign Het
Cyp3a13 G C 5: 137,909,883 (GRCm39) P147A probably damaging Het
Dennd2a C T 6: 39,473,907 (GRCm39) probably null Het
Dgkg T C 16: 22,298,157 (GRCm39) M743V possibly damaging Het
Dhx35 C T 2: 158,671,501 (GRCm39) R311W probably benign Het
Dnase1l2 A T 17: 24,660,049 (GRCm39) V273E probably damaging Het
Dock8 T G 19: 25,146,832 (GRCm39) I1437S possibly damaging Het
Dsg4 G A 18: 20,604,334 (GRCm39) V934I probably benign Het
Eef2 T A 10: 81,015,010 (GRCm39) F236L possibly damaging Het
Eml4 A G 17: 83,747,498 (GRCm39) I247V probably damaging Het
Evi5 A C 5: 107,947,120 (GRCm39) C451G probably benign Het
Fam124a T G 14: 62,824,883 (GRCm39) W126G probably damaging Het
Fbxw21 A G 9: 108,975,625 (GRCm39) I257T possibly damaging Het
Fn3krp A G 11: 121,312,304 (GRCm39) K6E probably benign Het
Gcn1 G A 5: 115,735,131 (GRCm39) W1149* probably null Het
Glud1 C T 14: 34,060,795 (GRCm39) R453* probably null Het
Gtf2f1 G A 17: 57,318,125 (GRCm39) probably benign Het
Gtpbp4 T A 13: 9,024,994 (GRCm39) D532V probably benign Het
Ifnar2 G A 16: 91,184,975 (GRCm39) R122H possibly damaging Het
Ift70b A T 2: 75,768,467 (GRCm39) Y95* probably null Het
Ipo11 A G 13: 107,061,556 (GRCm39) W35R probably damaging Het
Iqgap3 G A 3: 88,017,361 (GRCm39) R1115Q possibly damaging Het
Kifc5b A G 17: 27,142,239 (GRCm39) E239G probably damaging Het
Map3k7 A T 4: 32,019,519 (GRCm39) E553D probably damaging Het
Mdh1 G T 11: 21,512,926 (GRCm39) S146* probably null Het
Muc16 C A 9: 18,548,494 (GRCm39) W5933L probably benign Het
Myo16 C A 8: 10,620,401 (GRCm39) P1651T probably damaging Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Noxo1 G T 17: 24,915,386 (GRCm39) probably benign Het
Or4k49 T A 2: 111,495,230 (GRCm39) Y220N probably benign Het
Pcdhgb6 A T 18: 37,876,054 (GRCm39) N254I possibly damaging Het
Peli3 A T 19: 4,991,850 (GRCm39) C30* probably null Het
Plb1 T A 5: 32,512,731 (GRCm39) M1363K probably damaging Het
Ppp4r4 G T 12: 103,550,346 (GRCm39) E257* probably null Het
Rbm20 T G 19: 53,840,060 (GRCm39) S1016R probably benign Het
Rcn1 A T 2: 105,225,026 (GRCm39) L143Q possibly damaging Het
Retreg1 G A 15: 25,940,985 (GRCm39) G3D unknown Het
Rrm2 A G 12: 24,758,956 (GRCm39) N65D probably benign Het
Samhd1 G T 2: 156,965,219 (GRCm39) H199N probably damaging Het
Slain2 T A 5: 73,114,969 (GRCm39) L400* probably null Het
Slc26a7 A T 4: 14,522,862 (GRCm39) M486K probably benign Het
Slc30a4 A T 2: 122,536,456 (GRCm39) Y133N probably damaging Het
Spef2 A T 15: 9,601,945 (GRCm39) F1439Y unknown Het
Srpra T C 9: 35,122,670 (GRCm39) V29A possibly damaging Het
St3gal1 T C 15: 66,981,499 (GRCm39) T226A possibly damaging Het
Tas2r136 T A 6: 132,754,813 (GRCm39) I105F probably benign Het
Tmem208 A G 8: 106,061,506 (GRCm39) *177W probably null Het
Utrn T A 10: 12,610,921 (GRCm39) N478I probably damaging Het
Zbtb37 T C 1: 160,859,432 (GRCm39) Y291C probably damaging Het
Zc3h3 T G 15: 75,709,459 (GRCm39) H470P probably benign Het
Zfp40 A T 17: 23,395,863 (GRCm39) Y241* probably null Het
Zfp457 T C 13: 67,440,874 (GRCm39) N567S probably benign Het
Zfp458 C T 13: 67,408,217 (GRCm39) V33M probably damaging Het
Zfp953 A T 13: 67,491,478 (GRCm39) I158N possibly damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35,392,192 (GRCm39) splice site probably benign
IGL01351:Dpy19l3 APN 7 35,426,840 (GRCm39) splice site probably benign
IGL01622:Dpy19l3 APN 7 35,422,169 (GRCm39) missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35,422,169 (GRCm39) missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35,394,763 (GRCm39) missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35,411,343 (GRCm39) missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35,392,233 (GRCm39) missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35,452,097 (GRCm39) missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35,429,154 (GRCm39) nonsense probably null
IGL03374:Dpy19l3 APN 7 35,411,633 (GRCm39) missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35,413,640 (GRCm39) missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35,416,071 (GRCm39) missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35,416,071 (GRCm39) missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35,452,130 (GRCm39) missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35,394,741 (GRCm39) missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35,424,835 (GRCm39) nonsense probably null
R1640:Dpy19l3 UTSW 7 35,449,203 (GRCm39) missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35,407,580 (GRCm39) missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35,429,185 (GRCm39) missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35,426,713 (GRCm39) critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35,426,717 (GRCm39) nonsense probably null
R4438:Dpy19l3 UTSW 7 35,392,284 (GRCm39) missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35,411,326 (GRCm39) missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35,422,146 (GRCm39) missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35,402,926 (GRCm39) missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35,411,607 (GRCm39) nonsense probably null
R4915:Dpy19l3 UTSW 7 35,452,167 (GRCm39) utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35,407,467 (GRCm39) intron probably benign
R5300:Dpy19l3 UTSW 7 35,426,735 (GRCm39) missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35,413,555 (GRCm39) missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35,424,723 (GRCm39) missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35,449,272 (GRCm39) missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35,408,055 (GRCm39) missense probably benign
R7198:Dpy19l3 UTSW 7 35,449,190 (GRCm39) missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35,452,067 (GRCm39) missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35,452,106 (GRCm39) missense probably benign
R7641:Dpy19l3 UTSW 7 35,394,734 (GRCm39) missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35,394,734 (GRCm39) missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35,449,281 (GRCm39) missense probably benign
R8073:Dpy19l3 UTSW 7 35,429,173 (GRCm39) missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35,394,814 (GRCm39) missense probably damaging 0.96
R8206:Dpy19l3 UTSW 7 35,429,155 (GRCm39) missense probably damaging 1.00
R9299:Dpy19l3 UTSW 7 35,424,752 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGCCAGGAGCAGAAACATC -3'
(R):5'- TGAATTACAGTCGTTGCTCACTGC -3'

Sequencing Primer
(F):5'- GCGGCTGTCAGATAACTAACTG -3'
(R):5'- CCGAGGCAGTGGAGTTTATATTAC -3'
Posted On 2022-11-14