Mutagenetix > Incidental Mutation

Incidental Mutation 'R9765:Utrn'

733213

Institutional Source

Beutler Lab

Gene Symbol

Utrn

Ensembl Gene

ENSMUSG00000019820

Gene Name

utrophin

Synonyms

G-utrophin, Dmdl, DRP

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9765 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12257932-12745109 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12610921 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 478 (N478I)

Ref Sequence

ENSEMBL: ENSMUSP00000076093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217899] [ENSMUST00000218635] [ENSMUST00000219584] [ENSMUST00000219660]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076817
AA Change: N478I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: N478I

Domain	Start	End	E-Value	Type
CH	33	133	1.87e-24	SMART
CH	152	250	4.05e-20	SMART
SPEC	312	416	2.31e-18	SMART
SPEC	421	525	4.18e-16	SMART
SPEC	532	636	3.35e-6	SMART
low complexity region	665	679	N/A	INTRINSIC
SPEC	690	795	1.7e-7	SMART
SPEC	801	901	1e-4	SMART
SPEC	910	1012	8.24e-2	SMART
SPEC	1019	1121	1.32e-4	SMART
SPEC	1128	1229	2.64e-4	SMART
SPEC	1236	1333	4.42e-6	SMART
coiled coil region	1375	1401	N/A	INTRINSIC
SPEC	1438	1540	3.62e-2	SMART
SPEC	1547	1648	7.95e-1	SMART
SPEC	1655	1752	3.56e0	SMART
coiled coil region	1766	1795	N/A	INTRINSIC
SPEC	1870	1972	3.63e0	SMART
SPEC	1979	2080	5.15e-16	SMART
SPEC	2087	2183	3.71e0	SMART
SPEC	2227	2330	4.7e-10	SMART
SPEC	2337	2437	1.02e0	SMART
SPEC	2444	2553	2.35e-10	SMART
SPEC	2560	2685	8.77e-10	SMART
SPEC	2692	2794	4.13e-6	SMART
WW	2811	2843	5.59e-7	SMART
Pfam:EF-hand_2	2844	2962	3.8e-41	PFAM
Pfam:EF-hand_3	2966	3057	1.6e-39	PFAM
ZnF_ZZ	3062	3107	6.33e-17	SMART
coiled coil region	3250	3289	N/A	INTRINSIC
coiled coil region	3310	3354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217899
AA Change: N483I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218635
AA Change: N478I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219584
AA Change: N478I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219660
AA Change: N478I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,404,829 (GRCm39)	V25I	probably benign	Het
Actr1b	T	A	1: 36,741,677 (GRCm39)	H65L	probably benign	Het
Adgrf5	G	A	17: 43,748,491 (GRCm39)	G440E	probably damaging	Het
Ash1l	T	A	3: 88,930,500 (GRCm39)	D1992E	probably damaging	Het
Cacng4	A	G	11: 107,632,809 (GRCm39)	F81S	probably damaging	Het
Cdca8	A	G	4: 124,814,122 (GRCm39)	I223T	probably benign	Het
Cdh19	A	G	1: 110,823,111 (GRCm39)		probably null	Het
Ces2f	A	G	8: 105,676,678 (GRCm39)	D124G	probably damaging	Het
Cks1brt	A	G	8: 85,898,234 (GRCm39)	Y29C	probably damaging	Het
Cntnap4	T	C	8: 113,484,110 (GRCm39)	S388P	probably benign	Het
Cntnap4	T	C	8: 113,568,496 (GRCm39)	I844T	probably damaging	Het
Col4a3	G	A	1: 82,646,678 (GRCm39)	W396*	probably null	Het
Cul9	A	T	17: 46,850,224 (GRCm39)	S449T	probably benign	Het
Cux2	G	A	5: 122,007,195 (GRCm39)	P822L	probably benign	Het
Cyp3a13	G	C	5: 137,909,883 (GRCm39)	P147A	probably damaging	Het
Dennd2a	C	T	6: 39,473,907 (GRCm39)		probably null	Het
Dgkg	T	C	16: 22,298,157 (GRCm39)	M743V	possibly damaging	Het
Dhx35	C	T	2: 158,671,501 (GRCm39)	R311W	probably benign	Het
Dnase1l2	A	T	17: 24,660,049 (GRCm39)	V273E	probably damaging	Het
Dock8	T	G	19: 25,146,832 (GRCm39)	I1437S	possibly damaging	Het
Dpy19l3	T	C	7: 35,408,056 (GRCm39)	D450G	probably benign	Het
Dsg4	G	A	18: 20,604,334 (GRCm39)	V934I	probably benign	Het
Eef2	T	A	10: 81,015,010 (GRCm39)	F236L	possibly damaging	Het
Eml4	A	G	17: 83,747,498 (GRCm39)	I247V	probably damaging	Het
Evi5	A	C	5: 107,947,120 (GRCm39)	C451G	probably benign	Het
Fam124a	T	G	14: 62,824,883 (GRCm39)	W126G	probably damaging	Het
Fbxw21	A	G	9: 108,975,625 (GRCm39)	I257T	possibly damaging	Het
Fn3krp	A	G	11: 121,312,304 (GRCm39)	K6E	probably benign	Het
Gcn1	G	A	5: 115,735,131 (GRCm39)	W1149*	probably null	Het
Glud1	C	T	14: 34,060,795 (GRCm39)	R453*	probably null	Het
Gtf2f1	G	A	17: 57,318,125 (GRCm39)		probably benign	Het
Gtpbp4	T	A	13: 9,024,994 (GRCm39)	D532V	probably benign	Het
Ifnar2	G	A	16: 91,184,975 (GRCm39)	R122H	possibly damaging	Het
Ift70b	A	T	2: 75,768,467 (GRCm39)	Y95*	probably null	Het
Ipo11	A	G	13: 107,061,556 (GRCm39)	W35R	probably damaging	Het
Iqgap3	G	A	3: 88,017,361 (GRCm39)	R1115Q	possibly damaging	Het
Kifc5b	A	G	17: 27,142,239 (GRCm39)	E239G	probably damaging	Het
Map3k7	A	T	4: 32,019,519 (GRCm39)	E553D	probably damaging	Het
Mdh1	G	T	11: 21,512,926 (GRCm39)	S146*	probably null	Het
Muc16	C	A	9: 18,548,494 (GRCm39)	W5933L	probably benign	Het
Myo16	C	A	8: 10,620,401 (GRCm39)	P1651T	probably damaging	Het
Naip5	C	G	13: 100,367,269 (GRCm39)	A276P	probably damaging	Het
Noxo1	G	T	17: 24,915,386 (GRCm39)		probably benign	Het
Or4k49	T	A	2: 111,495,230 (GRCm39)	Y220N	probably benign	Het
Pcdhgb6	A	T	18: 37,876,054 (GRCm39)	N254I	possibly damaging	Het
Peli3	A	T	19: 4,991,850 (GRCm39)	C30*	probably null	Het
Plb1	T	A	5: 32,512,731 (GRCm39)	M1363K	probably damaging	Het
Ppp4r4	G	T	12: 103,550,346 (GRCm39)	E257*	probably null	Het
Rbm20	T	G	19: 53,840,060 (GRCm39)	S1016R	probably benign	Het
Rcn1	A	T	2: 105,225,026 (GRCm39)	L143Q	possibly damaging	Het
Retreg1	G	A	15: 25,940,985 (GRCm39)	G3D	unknown	Het
Rrm2	A	G	12: 24,758,956 (GRCm39)	N65D	probably benign	Het
Samhd1	G	T	2: 156,965,219 (GRCm39)	H199N	probably damaging	Het
Slain2	T	A	5: 73,114,969 (GRCm39)	L400*	probably null	Het
Slc26a7	A	T	4: 14,522,862 (GRCm39)	M486K	probably benign	Het
Slc30a4	A	T	2: 122,536,456 (GRCm39)	Y133N	probably damaging	Het
Spef2	A	T	15: 9,601,945 (GRCm39)	F1439Y	unknown	Het
Srpra	T	C	9: 35,122,670 (GRCm39)	V29A	possibly damaging	Het
St3gal1	T	C	15: 66,981,499 (GRCm39)	T226A	possibly damaging	Het
Tas2r136	T	A	6: 132,754,813 (GRCm39)	I105F	probably benign	Het
Tmem208	A	G	8: 106,061,506 (GRCm39)	*177W	probably null	Het
Zbtb37	T	C	1: 160,859,432 (GRCm39)	Y291C	probably damaging	Het
Zc3h3	T	G	15: 75,709,459 (GRCm39)	H470P	probably benign	Het
Zfp40	A	T	17: 23,395,863 (GRCm39)	Y241*	probably null	Het
Zfp457	T	C	13: 67,440,874 (GRCm39)	N567S	probably benign	Het
Zfp458	C	T	13: 67,408,217 (GRCm39)	V33M	probably damaging	Het
Zfp953	A	T	13: 67,491,478 (GRCm39)	I158N	possibly damaging	Het

Other mutations in Utrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Utrn	APN	10	12,547,574 (GRCm39)	missense	probably damaging	1.00
IGL00469:Utrn	APN	10	12,282,273 (GRCm39)	missense	probably damaging	1.00
IGL00518:Utrn	APN	10	12,542,587 (GRCm39)	splice site	probably benign
IGL00560:Utrn	APN	10	12,331,211 (GRCm39)	nonsense	probably null
IGL00589:Utrn	APN	10	12,554,362 (GRCm39)	missense	possibly damaging	0.53
IGL00662:Utrn	APN	10	12,540,705 (GRCm39)	missense	probably damaging	0.99
IGL00754:Utrn	APN	10	12,539,236 (GRCm39)	missense	probably benign	0.05
IGL00772:Utrn	APN	10	12,524,929 (GRCm39)	missense	probably benign
IGL00775:Utrn	APN	10	12,620,974 (GRCm39)	critical splice donor site	probably null
IGL00782:Utrn	APN	10	12,528,555 (GRCm39)	missense	probably benign	0.13
IGL00962:Utrn	APN	10	12,357,078 (GRCm39)	missense	possibly damaging	0.80
IGL01584:Utrn	APN	10	12,602,111 (GRCm39)	missense	probably benign	0.01
IGL01677:Utrn	APN	10	12,619,901 (GRCm39)	missense	probably damaging	1.00
IGL01695:Utrn	APN	10	12,621,086 (GRCm39)	missense	probably benign	0.00
IGL01743:Utrn	APN	10	12,587,301 (GRCm39)	missense	possibly damaging	0.94
IGL01815:Utrn	APN	10	12,528,460 (GRCm39)	missense	probably benign	0.00
IGL01901:Utrn	APN	10	12,516,672 (GRCm39)	missense	probably damaging	1.00
IGL01982:Utrn	APN	10	12,623,773 (GRCm39)	missense	probably damaging	1.00
IGL01983:Utrn	APN	10	12,545,525 (GRCm39)	missense	probably benign	0.18
IGL02031:Utrn	APN	10	12,610,948 (GRCm39)	missense	probably damaging	1.00
IGL02106:Utrn	APN	10	12,289,717 (GRCm39)	missense	possibly damaging	0.92
IGL02134:Utrn	APN	10	12,519,163 (GRCm39)	missense	probably damaging	0.99
IGL02209:Utrn	APN	10	12,559,039 (GRCm39)	missense	probably damaging	0.97
IGL02217:Utrn	APN	10	12,627,303 (GRCm39)	missense	probably damaging	1.00
IGL02250:Utrn	APN	10	12,312,135 (GRCm39)	missense	probably damaging	1.00
IGL02307:Utrn	APN	10	12,625,809 (GRCm39)	nonsense	probably null
IGL02386:Utrn	APN	10	12,297,352 (GRCm39)	missense	possibly damaging	0.91
IGL02494:Utrn	APN	10	12,585,798 (GRCm39)	missense	probably benign
IGL02631:Utrn	APN	10	12,585,807 (GRCm39)	missense	probably benign	0.00
IGL02729:Utrn	APN	10	12,596,554 (GRCm39)	unclassified	probably benign
IGL02736:Utrn	APN	10	12,297,384 (GRCm39)	missense	probably damaging	1.00
IGL02832:Utrn	APN	10	12,613,937 (GRCm39)	missense	possibly damaging	0.82
IGL02926:Utrn	APN	10	12,566,504 (GRCm39)	missense	probably damaging	0.96
IGL03184:Utrn	APN	10	12,585,910 (GRCm39)	missense	probably benign	0.04
IGL03194:Utrn	APN	10	12,282,173 (GRCm39)	splice site	probably benign
IGL03346:Utrn	APN	10	12,401,096 (GRCm39)	missense	probably benign	0.22
retiring	UTSW	10	12,516,764 (GRCm39)	missense	probably damaging	1.00
shrinking_violet	UTSW	10	12,587,329 (GRCm39)	critical splice acceptor site	probably null
Wallflower	UTSW	10	12,623,719 (GRCm39)	missense	probably damaging	1.00
FR4548:Utrn	UTSW	10	12,509,685 (GRCm39)	critical splice donor site	probably benign
I2288:Utrn	UTSW	10	12,297,384 (GRCm39)	missense	probably damaging	1.00
PIT4677001:Utrn	UTSW	10	12,542,448 (GRCm39)	missense	probably benign	0.06
R0022:Utrn	UTSW	10	12,585,700 (GRCm39)	splice site	probably benign
R0024:Utrn	UTSW	10	12,281,755 (GRCm39)	missense	probably benign	0.00
R0024:Utrn	UTSW	10	12,281,755 (GRCm39)	missense	probably benign	0.00
R0026:Utrn	UTSW	10	12,601,940 (GRCm39)	splice site	probably benign
R0026:Utrn	UTSW	10	12,601,940 (GRCm39)	splice site	probably benign
R0091:Utrn	UTSW	10	12,610,948 (GRCm39)	missense	probably damaging	1.00
R0112:Utrn	UTSW	10	12,562,209 (GRCm39)	nonsense	probably null
R0126:Utrn	UTSW	10	12,587,219 (GRCm39)	missense	probably benign	0.02
R0184:Utrn	UTSW	10	12,543,362 (GRCm39)	missense	probably benign
R0219:Utrn	UTSW	10	12,560,195 (GRCm39)	missense	probably damaging	1.00
R0369:Utrn	UTSW	10	12,509,766 (GRCm39)	missense	probably benign	0.37
R0390:Utrn	UTSW	10	12,585,804 (GRCm39)	missense	probably benign	0.05
R0391:Utrn	UTSW	10	12,401,077 (GRCm39)	splice site	probably benign
R0408:Utrn	UTSW	10	12,259,934 (GRCm39)	makesense	probably null
R0409:Utrn	UTSW	10	12,519,345 (GRCm39)	missense	probably benign	0.01
R0441:Utrn	UTSW	10	12,564,038 (GRCm39)	missense	probably null	0.88
R0504:Utrn	UTSW	10	12,278,639 (GRCm39)	missense	probably benign	0.02
R0730:Utrn	UTSW	10	12,573,902 (GRCm39)	splice site	probably benign
R1078:Utrn	UTSW	10	12,331,310 (GRCm39)	critical splice acceptor site	probably null
R1171:Utrn	UTSW	10	12,357,052 (GRCm39)	missense	probably damaging	0.99
R1191:Utrn	UTSW	10	12,509,777 (GRCm39)	missense	probably benign	0.02
R1203:Utrn	UTSW	10	12,362,281 (GRCm39)	missense	probably damaging	1.00
R1401:Utrn	UTSW	10	12,524,897 (GRCm39)	missense	probably benign
R1418:Utrn	UTSW	10	12,589,094 (GRCm39)	missense	probably benign
R1439:Utrn	UTSW	10	12,619,793 (GRCm39)	missense	possibly damaging	0.79
R1441:Utrn	UTSW	10	12,559,039 (GRCm39)	missense	probably damaging	0.97
R1445:Utrn	UTSW	10	12,554,318 (GRCm39)	splice site	probably benign
R1509:Utrn	UTSW	10	12,331,185 (GRCm39)	missense	possibly damaging	0.91
R1546:Utrn	UTSW	10	12,312,108 (GRCm39)	missense	probably damaging	1.00
R1585:Utrn	UTSW	10	12,312,029 (GRCm39)	missense	possibly damaging	0.62
R1621:Utrn	UTSW	10	12,589,027 (GRCm39)	missense	probably benign	0.24
R1637:Utrn	UTSW	10	12,312,108 (GRCm39)	missense	probably damaging	1.00
R1703:Utrn	UTSW	10	12,603,473 (GRCm39)	splice site	probably benign
R1725:Utrn	UTSW	10	12,539,263 (GRCm39)	missense	probably damaging	0.99
R1735:Utrn	UTSW	10	12,585,882 (GRCm39)	missense	probably benign
R1770:Utrn	UTSW	10	12,351,040 (GRCm39)	missense	probably damaging	0.98
R1778:Utrn	UTSW	10	12,312,108 (GRCm39)	missense	probably damaging	1.00
R1783:Utrn	UTSW	10	12,339,083 (GRCm39)	missense	probably damaging	1.00
R1818:Utrn	UTSW	10	12,585,708 (GRCm39)	critical splice donor site	probably null
R1829:Utrn	UTSW	10	12,351,018 (GRCm39)	missense	probably damaging	1.00
R1919:Utrn	UTSW	10	12,331,224 (GRCm39)	missense	probably benign	0.15
R1964:Utrn	UTSW	10	12,560,181 (GRCm39)	missense	probably damaging	1.00
R2080:Utrn	UTSW	10	12,612,826 (GRCm39)	missense	probably benign	0.36
R2092:Utrn	UTSW	10	12,554,442 (GRCm39)	missense	probably benign	0.12
R2107:Utrn	UTSW	10	12,312,108 (GRCm39)	missense	probably damaging	1.00
R2108:Utrn	UTSW	10	12,312,108 (GRCm39)	missense	probably damaging	1.00
R2760:Utrn	UTSW	10	12,566,622 (GRCm39)	missense	probably damaging	1.00
R2884:Utrn	UTSW	10	12,615,105 (GRCm39)	splice site	probably null
R2885:Utrn	UTSW	10	12,615,105 (GRCm39)	splice site	probably null
R2886:Utrn	UTSW	10	12,615,105 (GRCm39)	splice site	probably null
R2903:Utrn	UTSW	10	12,519,172 (GRCm39)	missense	probably damaging	1.00
R2944:Utrn	UTSW	10	12,519,163 (GRCm39)	missense	probably damaging	1.00
R2945:Utrn	UTSW	10	12,362,135 (GRCm39)	missense	possibly damaging	0.50
R3438:Utrn	UTSW	10	12,357,062 (GRCm39)	missense	probably damaging	0.98
R3683:Utrn	UTSW	10	12,542,579 (GRCm39)	missense	probably benign	0.10
R3735:Utrn	UTSW	10	12,354,228 (GRCm39)	missense	probably damaging	1.00
R3907:Utrn	UTSW	10	12,585,926 (GRCm39)	splice site	probably benign
R3923:Utrn	UTSW	10	12,615,223 (GRCm39)	missense	probably benign	0.23
R3925:Utrn	UTSW	10	12,573,786 (GRCm39)	missense	probably benign
R3926:Utrn	UTSW	10	12,573,786 (GRCm39)	missense	probably benign
R3938:Utrn	UTSW	10	12,625,774 (GRCm39)	critical splice donor site	probably null
R3941:Utrn	UTSW	10	12,587,329 (GRCm39)	critical splice acceptor site	probably null
R3958:Utrn	UTSW	10	12,625,852 (GRCm39)	missense	probably damaging	1.00
R4091:Utrn	UTSW	10	12,585,915 (GRCm39)	missense	probably benign	0.10
R4454:Utrn	UTSW	10	12,603,584 (GRCm39)	missense	possibly damaging	0.81
R4585:Utrn	UTSW	10	12,564,050 (GRCm39)	missense	probably benign	0.01
R4667:Utrn	UTSW	10	12,573,797 (GRCm39)	missense	probably benign	0.22
R4684:Utrn	UTSW	10	12,620,984 (GRCm39)	missense	probably damaging	1.00
R4782:Utrn	UTSW	10	12,625,813 (GRCm39)	missense	probably damaging	1.00
R4785:Utrn	UTSW	10	12,530,489 (GRCm39)	missense	probably benign	0.39
R4799:Utrn	UTSW	10	12,625,813 (GRCm39)	missense	probably damaging	1.00
R4829:Utrn	UTSW	10	12,539,205 (GRCm39)	missense	probably benign	0.00
R4878:Utrn	UTSW	10	12,603,502 (GRCm39)	missense	probably damaging	1.00
R4955:Utrn	UTSW	10	12,737,311 (GRCm39)	critical splice donor site	probably null
R4967:Utrn	UTSW	10	12,331,164 (GRCm39)	missense	probably damaging	0.99
R5071:Utrn	UTSW	10	12,259,948 (GRCm39)	splice site	probably null
R5072:Utrn	UTSW	10	12,259,948 (GRCm39)	splice site	probably null
R5186:Utrn	UTSW	10	12,604,521 (GRCm39)	missense	probably damaging	1.00
R5213:Utrn	UTSW	10	12,512,504 (GRCm39)	missense	probably damaging	1.00
R5296:Utrn	UTSW	10	12,277,099 (GRCm39)	missense	probably damaging	1.00
R5309:Utrn	UTSW	10	12,603,513 (GRCm39)	missense	probably damaging	1.00
R5312:Utrn	UTSW	10	12,603,513 (GRCm39)	missense	probably damaging	1.00
R5399:Utrn	UTSW	10	12,516,727 (GRCm39)	missense	probably damaging	1.00
R5407:Utrn	UTSW	10	12,556,369 (GRCm39)	missense	probably damaging	1.00
R5411:Utrn	UTSW	10	12,524,929 (GRCm39)	missense	probably benign
R5428:Utrn	UTSW	10	12,569,175 (GRCm39)	missense	probably benign	0.09
R5595:Utrn	UTSW	10	12,558,062 (GRCm39)	missense	possibly damaging	0.89
R5602:Utrn	UTSW	10	12,625,839 (GRCm39)	missense	probably damaging	1.00
R5608:Utrn	UTSW	10	12,547,581 (GRCm39)	missense	probably benign	0.00
R5678:Utrn	UTSW	10	12,317,762 (GRCm39)	missense	probably damaging	1.00
R5726:Utrn	UTSW	10	12,545,550 (GRCm39)	missense	probably benign
R5804:Utrn	UTSW	10	12,297,369 (GRCm39)	missense	probably damaging	1.00
R5916:Utrn	UTSW	10	12,540,795 (GRCm39)	missense	probably damaging	0.97
R5941:Utrn	UTSW	10	12,362,227 (GRCm39)	missense	probably damaging	1.00
R6014:Utrn	UTSW	10	12,566,620 (GRCm39)	missense	probably benign	0.01
R6015:Utrn	UTSW	10	12,354,168 (GRCm39)	missense	possibly damaging	0.85
R6028:Utrn	UTSW	10	12,530,460 (GRCm39)	missense	probably benign	0.00
R6158:Utrn	UTSW	10	12,566,566 (GRCm39)	missense	probably benign	0.04
R6181:Utrn	UTSW	10	12,615,200 (GRCm39)	missense	probably damaging	1.00
R6300:Utrn	UTSW	10	12,377,220 (GRCm39)	missense	probably benign	0.35
R6367:Utrn	UTSW	10	12,623,719 (GRCm39)	missense	probably damaging	1.00
R6377:Utrn	UTSW	10	12,619,827 (GRCm39)	missense	probably damaging	1.00
R6434:Utrn	UTSW	10	12,401,171 (GRCm39)	missense	probably damaging	1.00
R6498:Utrn	UTSW	10	12,317,837 (GRCm39)	missense	probably benign
R6579:Utrn	UTSW	10	12,623,750 (GRCm39)	missense	probably benign	0.05
R6704:Utrn	UTSW	10	12,621,035 (GRCm39)	missense	probably damaging	0.99
R6736:Utrn	UTSW	10	12,497,047 (GRCm39)	missense	probably benign	0.09
R6755:Utrn	UTSW	10	12,574,831 (GRCm39)	missense	probably benign	0.00
R6793:Utrn	UTSW	10	12,574,844 (GRCm39)	missense	possibly damaging	0.69
R6793:Utrn	UTSW	10	12,516,669 (GRCm39)	critical splice donor site	probably null
R6835:Utrn	UTSW	10	12,603,508 (GRCm39)	missense	probably damaging	1.00
R6919:Utrn	UTSW	10	12,569,214 (GRCm39)	nonsense	probably null
R6920:Utrn	UTSW	10	12,626,214 (GRCm39)	missense	probably damaging	0.98
R7037:Utrn	UTSW	10	12,702,514 (GRCm39)	splice site	probably null
R7038:Utrn	UTSW	10	12,558,082 (GRCm39)	missense	probably damaging	1.00
R7055:Utrn	UTSW	10	12,623,665 (GRCm39)	missense	probably benign	0.23
R7072:Utrn	UTSW	10	12,340,957 (GRCm39)	missense	probably damaging	1.00
R7090:Utrn	UTSW	10	12,560,260 (GRCm39)	missense	possibly damaging	0.58
R7211:Utrn	UTSW	10	12,277,079 (GRCm39)	missense	possibly damaging	0.72
R7248:Utrn	UTSW	10	12,604,562 (GRCm39)	missense	possibly damaging	0.51
R7305:Utrn	UTSW	10	12,261,280 (GRCm39)	missense	probably benign
R7334:Utrn	UTSW	10	12,603,753 (GRCm39)	splice site	probably null
R7348:Utrn	UTSW	10	12,623,762 (GRCm39)	missense	probably damaging	1.00
R7375:Utrn	UTSW	10	12,516,764 (GRCm39)	missense	probably damaging	1.00
R7436:Utrn	UTSW	10	12,315,535 (GRCm39)	missense	possibly damaging	0.72
R7476:Utrn	UTSW	10	12,516,695 (GRCm39)	missense	probably benign
R7514:Utrn	UTSW	10	12,573,833 (GRCm39)	missense	probably benign	0.00
R7527:Utrn	UTSW	10	12,277,126 (GRCm39)	missense	possibly damaging	0.81
R7735:Utrn	UTSW	10	12,619,787 (GRCm39)	critical splice donor site	probably null
R7748:Utrn	UTSW	10	12,490,252 (GRCm39)	missense	probably benign	0.01
R7778:Utrn	UTSW	10	12,362,354 (GRCm39)	missense	probably damaging	1.00
R7824:Utrn	UTSW	10	12,362,354 (GRCm39)	missense	probably damaging	1.00
R7826:Utrn	UTSW	10	12,277,050 (GRCm39)	splice site	probably null
R7872:Utrn	UTSW	10	12,573,873 (GRCm39)	missense	probably benign
R7915:Utrn	UTSW	10	12,340,956 (GRCm39)	missense	probably damaging	1.00
R7922:Utrn	UTSW	10	12,543,271 (GRCm39)	missense	possibly damaging	0.68
R8081:Utrn	UTSW	10	12,423,803 (GRCm39)	start gained	probably benign
R8132:Utrn	UTSW	10	12,558,154 (GRCm39)	missense	probably damaging	0.99
R8167:Utrn	UTSW	10	12,547,558 (GRCm39)	nonsense	probably null
R8186:Utrn	UTSW	10	12,573,867 (GRCm39)	missense	probably benign
R8331:Utrn	UTSW	10	12,490,363 (GRCm39)	missense	probably benign	0.00
R8352:Utrn	UTSW	10	12,689,253 (GRCm39)	missense	probably benign	0.34
R8408:Utrn	UTSW	10	12,545,887 (GRCm39)	missense	possibly damaging	0.69
R8452:Utrn	UTSW	10	12,689,253 (GRCm39)	missense	probably benign	0.34
R8478:Utrn	UTSW	10	12,524,892 (GRCm39)	missense	probably benign
R8489:Utrn	UTSW	10	12,587,190 (GRCm39)	missense	probably benign	0.05
R8516:Utrn	UTSW	10	12,362,254 (GRCm39)	missense	probably damaging	0.99
R8520:Utrn	UTSW	10	12,545,930 (GRCm39)	nonsense	probably null
R8550:Utrn	UTSW	10	12,689,329 (GRCm39)	intron	probably benign
R8856:Utrn	UTSW	10	12,543,351 (GRCm39)	missense	probably benign
R8881:Utrn	UTSW	10	12,423,737 (GRCm39)	missense	possibly damaging	0.46
R9180:Utrn	UTSW	10	12,545,463 (GRCm39)	missense	probably damaging	1.00
R9186:Utrn	UTSW	10	12,490,318 (GRCm39)	missense	probably benign
R9216:Utrn	UTSW	10	12,689,229 (GRCm39)	missense	probably benign	0.19
R9251:Utrn	UTSW	10	12,512,531 (GRCm39)	missense	probably benign	0.01
R9273:Utrn	UTSW	10	12,509,707 (GRCm39)	missense	probably damaging	0.97
R9307:Utrn	UTSW	10	12,554,475 (GRCm39)	missense	probably benign	0.02
R9344:Utrn	UTSW	10	12,560,275 (GRCm39)	missense	probably benign	0.17
R9419:Utrn	UTSW	10	12,564,125 (GRCm39)	missense	probably damaging	1.00
R9435:Utrn	UTSW	10	12,519,173 (GRCm39)	missense	probably damaging	1.00
R9623:Utrn	UTSW	10	12,282,225 (GRCm39)	missense	probably damaging	1.00
R9650:Utrn	UTSW	10	12,613,929 (GRCm39)	missense	probably benign	0.00
R9653:Utrn	UTSW	10	12,539,189 (GRCm39)	missense	probably benign	0.41
R9653:Utrn	UTSW	10	12,497,123 (GRCm39)	missense	probably benign	0.17
R9672:Utrn	UTSW	10	12,603,613 (GRCm39)	missense	possibly damaging	0.68
R9678:Utrn	UTSW	10	12,615,159 (GRCm39)	missense	probably benign	0.00
R9741:Utrn	UTSW	10	12,702,564 (GRCm39)	missense	probably benign
R9799:Utrn	UTSW	10	12,585,736 (GRCm39)	missense	probably benign	0.01
RF009:Utrn	UTSW	10	12,509,689 (GRCm39)	nonsense	probably null
V1662:Utrn	UTSW	10	12,297,384 (GRCm39)	missense	probably damaging	1.00
X0018:Utrn	UTSW	10	12,610,942 (GRCm39)	missense	probably damaging	1.00
Z1176:Utrn	UTSW	10	12,564,173 (GRCm39)	critical splice acceptor site	probably null
Z1176:Utrn	UTSW	10	12,558,104 (GRCm39)	nonsense	probably null
Z1177:Utrn	UTSW	10	12,497,123 (GRCm39)	missense	probably benign	0.17
Z1177:Utrn	UTSW	10	12,401,150 (GRCm39)	nonsense	probably null
Z1186:Utrn	UTSW	10	12,545,491 (GRCm39)	missense	probably damaging	1.00
Z1189:Utrn	UTSW	10	12,545,491 (GRCm39)	missense	probably damaging	1.00
Z1191:Utrn	UTSW	10	12,545,491 (GRCm39)	missense	probably damaging	1.00
Z1192:Utrn	UTSW	10	12,545,491 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGTACAAACAAGGATGCCCAG -3'
(R):5'- TCTGGCTCCTAATGAAATGTAAGGG -3'

Sequencing Primer
(F):5'- TGCCCAGGAGGAACAATACATG -3'
(R):5'- CCTAATGAAATGTAAGGGTGTGTTC -3'

Posted On

2022-11-14