Incidental Mutation 'R9765:Fn3krp'
ID 733218
Institutional Source Beutler Lab
Gene Symbol Fn3krp
Ensembl Gene ENSMUSG00000039253
Gene Name fructosamine 3 kinase related protein
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 121312227-121322114 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121312304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 6 (K6E)
Ref Sequence ENSEMBL: ENSMUSP00000038061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038096]
AlphaFold Q8K274
Predicted Effect probably benign
Transcript: ENSMUST00000038096
AA Change: K6E

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038061
Gene: ENSMUSG00000039253
AA Change: K6E

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 6e-81 PFAM
Pfam:APH 22 267 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,404,829 (GRCm39) V25I probably benign Het
Actr1b T A 1: 36,741,677 (GRCm39) H65L probably benign Het
Adgrf5 G A 17: 43,748,491 (GRCm39) G440E probably damaging Het
Ash1l T A 3: 88,930,500 (GRCm39) D1992E probably damaging Het
Cacng4 A G 11: 107,632,809 (GRCm39) F81S probably damaging Het
Cdca8 A G 4: 124,814,122 (GRCm39) I223T probably benign Het
Cdh19 A G 1: 110,823,111 (GRCm39) probably null Het
Ces2f A G 8: 105,676,678 (GRCm39) D124G probably damaging Het
Cks1brt A G 8: 85,898,234 (GRCm39) Y29C probably damaging Het
Cntnap4 T C 8: 113,484,110 (GRCm39) S388P probably benign Het
Cntnap4 T C 8: 113,568,496 (GRCm39) I844T probably damaging Het
Col4a3 G A 1: 82,646,678 (GRCm39) W396* probably null Het
Cul9 A T 17: 46,850,224 (GRCm39) S449T probably benign Het
Cux2 G A 5: 122,007,195 (GRCm39) P822L probably benign Het
Cyp3a13 G C 5: 137,909,883 (GRCm39) P147A probably damaging Het
Dennd2a C T 6: 39,473,907 (GRCm39) probably null Het
Dgkg T C 16: 22,298,157 (GRCm39) M743V possibly damaging Het
Dhx35 C T 2: 158,671,501 (GRCm39) R311W probably benign Het
Dnase1l2 A T 17: 24,660,049 (GRCm39) V273E probably damaging Het
Dock8 T G 19: 25,146,832 (GRCm39) I1437S possibly damaging Het
Dpy19l3 T C 7: 35,408,056 (GRCm39) D450G probably benign Het
Dsg4 G A 18: 20,604,334 (GRCm39) V934I probably benign Het
Eef2 T A 10: 81,015,010 (GRCm39) F236L possibly damaging Het
Eml4 A G 17: 83,747,498 (GRCm39) I247V probably damaging Het
Evi5 A C 5: 107,947,120 (GRCm39) C451G probably benign Het
Fam124a T G 14: 62,824,883 (GRCm39) W126G probably damaging Het
Fbxw21 A G 9: 108,975,625 (GRCm39) I257T possibly damaging Het
Gcn1 G A 5: 115,735,131 (GRCm39) W1149* probably null Het
Glud1 C T 14: 34,060,795 (GRCm39) R453* probably null Het
Gtf2f1 G A 17: 57,318,125 (GRCm39) probably benign Het
Gtpbp4 T A 13: 9,024,994 (GRCm39) D532V probably benign Het
Ifnar2 G A 16: 91,184,975 (GRCm39) R122H possibly damaging Het
Ift70b A T 2: 75,768,467 (GRCm39) Y95* probably null Het
Ipo11 A G 13: 107,061,556 (GRCm39) W35R probably damaging Het
Iqgap3 G A 3: 88,017,361 (GRCm39) R1115Q possibly damaging Het
Kifc5b A G 17: 27,142,239 (GRCm39) E239G probably damaging Het
Map3k7 A T 4: 32,019,519 (GRCm39) E553D probably damaging Het
Mdh1 G T 11: 21,512,926 (GRCm39) S146* probably null Het
Muc16 C A 9: 18,548,494 (GRCm39) W5933L probably benign Het
Myo16 C A 8: 10,620,401 (GRCm39) P1651T probably damaging Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Noxo1 G T 17: 24,915,386 (GRCm39) probably benign Het
Or4k49 T A 2: 111,495,230 (GRCm39) Y220N probably benign Het
Pcdhgb6 A T 18: 37,876,054 (GRCm39) N254I possibly damaging Het
Peli3 A T 19: 4,991,850 (GRCm39) C30* probably null Het
Plb1 T A 5: 32,512,731 (GRCm39) M1363K probably damaging Het
Ppp4r4 G T 12: 103,550,346 (GRCm39) E257* probably null Het
Rbm20 T G 19: 53,840,060 (GRCm39) S1016R probably benign Het
Rcn1 A T 2: 105,225,026 (GRCm39) L143Q possibly damaging Het
Retreg1 G A 15: 25,940,985 (GRCm39) G3D unknown Het
Rrm2 A G 12: 24,758,956 (GRCm39) N65D probably benign Het
Samhd1 G T 2: 156,965,219 (GRCm39) H199N probably damaging Het
Slain2 T A 5: 73,114,969 (GRCm39) L400* probably null Het
Slc26a7 A T 4: 14,522,862 (GRCm39) M486K probably benign Het
Slc30a4 A T 2: 122,536,456 (GRCm39) Y133N probably damaging Het
Spef2 A T 15: 9,601,945 (GRCm39) F1439Y unknown Het
Srpra T C 9: 35,122,670 (GRCm39) V29A possibly damaging Het
St3gal1 T C 15: 66,981,499 (GRCm39) T226A possibly damaging Het
Tas2r136 T A 6: 132,754,813 (GRCm39) I105F probably benign Het
Tmem208 A G 8: 106,061,506 (GRCm39) *177W probably null Het
Utrn T A 10: 12,610,921 (GRCm39) N478I probably damaging Het
Zbtb37 T C 1: 160,859,432 (GRCm39) Y291C probably damaging Het
Zc3h3 T G 15: 75,709,459 (GRCm39) H470P probably benign Het
Zfp40 A T 17: 23,395,863 (GRCm39) Y241* probably null Het
Zfp457 T C 13: 67,440,874 (GRCm39) N567S probably benign Het
Zfp458 C T 13: 67,408,217 (GRCm39) V33M probably damaging Het
Zfp953 A T 13: 67,491,478 (GRCm39) I158N possibly damaging Het
Other mutations in Fn3krp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fn3krp APN 11 121,312,380 (GRCm39) missense probably damaging 1.00
IGL01633:Fn3krp APN 11 121,320,533 (GRCm39) nonsense probably null
IGL02123:Fn3krp APN 11 121,320,270 (GRCm39) missense probably benign 0.00
IGL03189:Fn3krp APN 11 121,320,456 (GRCm39) missense probably damaging 1.00
R0278:Fn3krp UTSW 11 121,312,406 (GRCm39) missense probably damaging 1.00
R1927:Fn3krp UTSW 11 121,315,803 (GRCm39) missense probably damaging 0.99
R3744:Fn3krp UTSW 11 121,317,531 (GRCm39) critical splice donor site probably null
R4471:Fn3krp UTSW 11 121,317,499 (GRCm39) missense probably benign 0.01
R4850:Fn3krp UTSW 11 121,315,879 (GRCm39) missense possibly damaging 0.56
R5027:Fn3krp UTSW 11 121,320,274 (GRCm39) missense probably benign 0.01
R5162:Fn3krp UTSW 11 121,320,410 (GRCm39) missense probably damaging 1.00
R5444:Fn3krp UTSW 11 121,312,430 (GRCm39) critical splice donor site probably null
R6230:Fn3krp UTSW 11 121,316,418 (GRCm39) missense probably damaging 1.00
R7183:Fn3krp UTSW 11 121,312,431 (GRCm39) critical splice donor site probably null
R8802:Fn3krp UTSW 11 121,315,813 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACTTGGCAGCGGTCTC -3'
(R):5'- GTCAGCTCAGGATCTCACAC -3'

Sequencing Primer
(F):5'- TCTGCCTCTCAACCAATCCTAAC -3'
(R):5'- GCCCCATTTTAGCCTCGGG -3'
Posted On 2022-11-14