Incidental Mutation 'R9765:Naip5'
ID 733225
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 100230761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 276 (A276P)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably damaging
Transcript: ENSMUST00000049789
AA Change: A276P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: A276P

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,454,829 V25I probably benign Het
Actr1b T A 1: 36,702,596 H65L probably benign Het
Adgrf5 G A 17: 43,437,600 G440E probably damaging Het
Ash1l T A 3: 89,023,193 D1992E probably damaging Het
Cacng4 A G 11: 107,741,983 F81S probably damaging Het
Cdca8 A G 4: 124,920,329 I223T probably benign Het
Cdh19 A G 1: 110,895,381 probably null Het
Ces2f A G 8: 104,950,046 D124G probably damaging Het
Cks1brt A G 8: 85,171,605 Y29C probably damaging Het
Cntnap4 T C 8: 112,757,478 S388P probably benign Het
Cntnap4 T C 8: 112,841,864 I844T probably damaging Het
Col4a3 G A 1: 82,668,957 W396* probably null Het
Cul9 A T 17: 46,539,298 S449T probably benign Het
Cux2 G A 5: 121,869,132 P822L probably benign Het
Cyp3a13 G C 5: 137,911,621 P147A probably damaging Het
Dennd2a C T 6: 39,496,973 probably null Het
Dgkg T C 16: 22,479,407 M743V possibly damaging Het
Dhx35 C T 2: 158,829,581 R311W probably benign Het
Dnase1l2 A T 17: 24,441,075 V273E probably damaging Het
Dock8 T G 19: 25,169,468 I1437S possibly damaging Het
Dpy19l3 T C 7: 35,708,631 D450G probably benign Het
Dsg4 G A 18: 20,471,277 V934I probably benign Het
Eef2 T A 10: 81,179,176 F236L possibly damaging Het
Eml4 A G 17: 83,440,069 I247V probably damaging Het
Evi5 A C 5: 107,799,254 C451G probably benign Het
Fam124a T G 14: 62,587,434 W126G probably damaging Het
Fbxw21 A G 9: 109,146,557 I257T possibly damaging Het
Fn3krp A G 11: 121,421,478 K6E probably benign Het
Gcn1l1 G A 5: 115,597,072 W1149* probably null Het
Glud1 C T 14: 34,338,838 R453* probably null Het
Gtf2f1 G A 17: 57,011,125 probably benign Het
Gtpbp4 T A 13: 8,974,958 D532V probably benign Het
Ifnar2 G A 16: 91,388,087 R122H possibly damaging Het
Ipo11 A G 13: 106,925,048 W35R probably damaging Het
Iqgap3 G A 3: 88,110,054 R1115Q possibly damaging Het
Kifc5b A G 17: 26,923,265 E239G probably damaging Het
Map3k7 A T 4: 32,019,519 E553D probably damaging Het
Mdh1 G T 11: 21,562,926 S146* probably null Het
Muc16 C A 9: 18,637,198 W5933L probably benign Het
Myo16 C A 8: 10,570,401 P1651T probably damaging Het
Noxo1 G T 17: 24,696,412 probably benign Het
Olfr1299 T A 2: 111,664,885 Y220N probably benign Het
Pcdhgb6 A T 18: 37,743,001 N254I possibly damaging Het
Peli3 A T 19: 4,941,822 C30* probably null Het
Plb1 T A 5: 32,355,387 M1363K probably damaging Het
Ppp4r4 G T 12: 103,584,087 E257* probably null Het
Rbm20 T G 19: 53,851,629 S1016R probably benign Het
Rcn1 A T 2: 105,394,681 L143Q possibly damaging Het
Retreg1 G A 15: 25,940,899 G3D unknown Het
Rrm2 A G 12: 24,708,957 N65D probably benign Het
Samhd1 G T 2: 157,123,299 H199N probably damaging Het
Slain2 T A 5: 72,957,626 L400* probably null Het
Slc26a7 A T 4: 14,522,862 M486K probably benign Het
Slc30a4 A T 2: 122,694,536 Y133N probably damaging Het
Spef2 A T 15: 9,601,859 F1439Y unknown Het
Srpr T C 9: 35,211,374 V29A possibly damaging Het
St3gal1 T C 15: 67,109,650 T226A possibly damaging Het
Tas2r136 T A 6: 132,777,850 I105F probably benign Het
Tmem208 A G 8: 105,334,874 *177W probably null Het
Ttc30b A T 2: 75,938,123 Y95* probably null Het
Utrn T A 10: 12,735,177 N478I probably damaging Het
Zbtb37 T C 1: 161,031,862 Y291C probably damaging Het
Zc3h3 T G 15: 75,837,610 H470P probably benign Het
Zfp40 A T 17: 23,176,889 Y241* probably null Het
Zfp457 T C 13: 67,292,810 N567S probably benign Het
Zfp458 C T 13: 67,260,153 V33M probably damaging Het
Zfp953 A T 13: 67,343,414 I158N possibly damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
R9725:Naip5 UTSW 13 100222276 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100230761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTGTCAGCCTAGACCTCAGC -3'
(R):5'- GGTGATGAAAGCACAGGTCATC -3'

Sequencing Primer
(F):5'- AGCCTAGACCTCAGCTGAGC -3'
(R):5'- GCACAGGTCATCAGATTATTACAC -3'
Posted On 2022-11-14