Incidental Mutation 'R9765:Dsg4'
ID 733243
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20604334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 934 (V934I)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: V934I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V934I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,404,829 (GRCm39) V25I probably benign Het
Actr1b T A 1: 36,741,677 (GRCm39) H65L probably benign Het
Adgrf5 G A 17: 43,748,491 (GRCm39) G440E probably damaging Het
Ash1l T A 3: 88,930,500 (GRCm39) D1992E probably damaging Het
Cacng4 A G 11: 107,632,809 (GRCm39) F81S probably damaging Het
Cdca8 A G 4: 124,814,122 (GRCm39) I223T probably benign Het
Cdh19 A G 1: 110,823,111 (GRCm39) probably null Het
Ces2f A G 8: 105,676,678 (GRCm39) D124G probably damaging Het
Cks1brt A G 8: 85,898,234 (GRCm39) Y29C probably damaging Het
Cntnap4 T C 8: 113,484,110 (GRCm39) S388P probably benign Het
Cntnap4 T C 8: 113,568,496 (GRCm39) I844T probably damaging Het
Col4a3 G A 1: 82,646,678 (GRCm39) W396* probably null Het
Cul9 A T 17: 46,850,224 (GRCm39) S449T probably benign Het
Cux2 G A 5: 122,007,195 (GRCm39) P822L probably benign Het
Cyp3a13 G C 5: 137,909,883 (GRCm39) P147A probably damaging Het
Dennd2a C T 6: 39,473,907 (GRCm39) probably null Het
Dgkg T C 16: 22,298,157 (GRCm39) M743V possibly damaging Het
Dhx35 C T 2: 158,671,501 (GRCm39) R311W probably benign Het
Dnase1l2 A T 17: 24,660,049 (GRCm39) V273E probably damaging Het
Dock8 T G 19: 25,146,832 (GRCm39) I1437S possibly damaging Het
Dpy19l3 T C 7: 35,408,056 (GRCm39) D450G probably benign Het
Eef2 T A 10: 81,015,010 (GRCm39) F236L possibly damaging Het
Eml4 A G 17: 83,747,498 (GRCm39) I247V probably damaging Het
Evi5 A C 5: 107,947,120 (GRCm39) C451G probably benign Het
Fam124a T G 14: 62,824,883 (GRCm39) W126G probably damaging Het
Fbxw21 A G 9: 108,975,625 (GRCm39) I257T possibly damaging Het
Fn3krp A G 11: 121,312,304 (GRCm39) K6E probably benign Het
Gcn1 G A 5: 115,735,131 (GRCm39) W1149* probably null Het
Glud1 C T 14: 34,060,795 (GRCm39) R453* probably null Het
Gtf2f1 G A 17: 57,318,125 (GRCm39) probably benign Het
Gtpbp4 T A 13: 9,024,994 (GRCm39) D532V probably benign Het
Ifnar2 G A 16: 91,184,975 (GRCm39) R122H possibly damaging Het
Ift70b A T 2: 75,768,467 (GRCm39) Y95* probably null Het
Ipo11 A G 13: 107,061,556 (GRCm39) W35R probably damaging Het
Iqgap3 G A 3: 88,017,361 (GRCm39) R1115Q possibly damaging Het
Kifc5b A G 17: 27,142,239 (GRCm39) E239G probably damaging Het
Map3k7 A T 4: 32,019,519 (GRCm39) E553D probably damaging Het
Mdh1 G T 11: 21,512,926 (GRCm39) S146* probably null Het
Muc16 C A 9: 18,548,494 (GRCm39) W5933L probably benign Het
Myo16 C A 8: 10,620,401 (GRCm39) P1651T probably damaging Het
Naip5 C G 13: 100,367,269 (GRCm39) A276P probably damaging Het
Noxo1 G T 17: 24,915,386 (GRCm39) probably benign Het
Or4k49 T A 2: 111,495,230 (GRCm39) Y220N probably benign Het
Pcdhgb6 A T 18: 37,876,054 (GRCm39) N254I possibly damaging Het
Peli3 A T 19: 4,991,850 (GRCm39) C30* probably null Het
Plb1 T A 5: 32,512,731 (GRCm39) M1363K probably damaging Het
Ppp4r4 G T 12: 103,550,346 (GRCm39) E257* probably null Het
Rbm20 T G 19: 53,840,060 (GRCm39) S1016R probably benign Het
Rcn1 A T 2: 105,225,026 (GRCm39) L143Q possibly damaging Het
Retreg1 G A 15: 25,940,985 (GRCm39) G3D unknown Het
Rrm2 A G 12: 24,758,956 (GRCm39) N65D probably benign Het
Samhd1 G T 2: 156,965,219 (GRCm39) H199N probably damaging Het
Slain2 T A 5: 73,114,969 (GRCm39) L400* probably null Het
Slc26a7 A T 4: 14,522,862 (GRCm39) M486K probably benign Het
Slc30a4 A T 2: 122,536,456 (GRCm39) Y133N probably damaging Het
Spef2 A T 15: 9,601,945 (GRCm39) F1439Y unknown Het
Srpra T C 9: 35,122,670 (GRCm39) V29A possibly damaging Het
St3gal1 T C 15: 66,981,499 (GRCm39) T226A possibly damaging Het
Tas2r136 T A 6: 132,754,813 (GRCm39) I105F probably benign Het
Tmem208 A G 8: 106,061,506 (GRCm39) *177W probably null Het
Utrn T A 10: 12,610,921 (GRCm39) N478I probably damaging Het
Zbtb37 T C 1: 160,859,432 (GRCm39) Y291C probably damaging Het
Zc3h3 T G 15: 75,709,459 (GRCm39) H470P probably benign Het
Zfp40 A T 17: 23,395,863 (GRCm39) Y241* probably null Het
Zfp457 T C 13: 67,440,874 (GRCm39) N567S probably benign Het
Zfp458 C T 13: 67,408,217 (GRCm39) V33M probably damaging Het
Zfp953 A T 13: 67,491,478 (GRCm39) I158N possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACCAGGCCTGTATACC -3'
(R):5'- TCACTGGTCCTATACATGCATC -3'

Sequencing Primer
(F):5'- GGCCTGTATACCAATCAGCACTG -3'
(R):5'- CTGGTCCTATACATGCATCACTAATG -3'
Posted On 2022-11-14