Incidental Mutation 'R9765:Dsg4'
ID 733243
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20471277 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 934 (V934I)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: V934I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V934I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,454,829 V25I probably benign Het
Actr1b T A 1: 36,702,596 H65L probably benign Het
Adgrf5 G A 17: 43,437,600 G440E probably damaging Het
Ash1l T A 3: 89,023,193 D1992E probably damaging Het
Cacng4 A G 11: 107,741,983 F81S probably damaging Het
Cdca8 A G 4: 124,920,329 I223T probably benign Het
Cdh19 A G 1: 110,895,381 probably null Het
Ces2f A G 8: 104,950,046 D124G probably damaging Het
Cks1brt A G 8: 85,171,605 Y29C probably damaging Het
Cntnap4 T C 8: 112,757,478 S388P probably benign Het
Cntnap4 T C 8: 112,841,864 I844T probably damaging Het
Col4a3 G A 1: 82,668,957 W396* probably null Het
Cul9 A T 17: 46,539,298 S449T probably benign Het
Cux2 G A 5: 121,869,132 P822L probably benign Het
Cyp3a13 G C 5: 137,911,621 P147A probably damaging Het
Dennd2a C T 6: 39,496,973 probably null Het
Dgkg T C 16: 22,479,407 M743V possibly damaging Het
Dhx35 C T 2: 158,829,581 R311W probably benign Het
Dnase1l2 A T 17: 24,441,075 V273E probably damaging Het
Dock8 T G 19: 25,169,468 I1437S possibly damaging Het
Dpy19l3 T C 7: 35,708,631 D450G probably benign Het
Eef2 T A 10: 81,179,176 F236L possibly damaging Het
Eml4 A G 17: 83,440,069 I247V probably damaging Het
Evi5 A C 5: 107,799,254 C451G probably benign Het
Fam124a T G 14: 62,587,434 W126G probably damaging Het
Fbxw21 A G 9: 109,146,557 I257T possibly damaging Het
Fn3krp A G 11: 121,421,478 K6E probably benign Het
Gcn1l1 G A 5: 115,597,072 W1149* probably null Het
Glud1 C T 14: 34,338,838 R453* probably null Het
Gtf2f1 G A 17: 57,011,125 probably benign Het
Gtpbp4 T A 13: 8,974,958 D532V probably benign Het
Ifnar2 G A 16: 91,388,087 R122H possibly damaging Het
Ipo11 A G 13: 106,925,048 W35R probably damaging Het
Iqgap3 G A 3: 88,110,054 R1115Q possibly damaging Het
Kifc5b A G 17: 26,923,265 E239G probably damaging Het
Map3k7 A T 4: 32,019,519 E553D probably damaging Het
Mdh1 G T 11: 21,562,926 S146* probably null Het
Muc16 C A 9: 18,637,198 W5933L probably benign Het
Myo16 C A 8: 10,570,401 P1651T probably damaging Het
Naip5 C G 13: 100,230,761 A276P probably damaging Het
Noxo1 G T 17: 24,696,412 probably benign Het
Olfr1299 T A 2: 111,664,885 Y220N probably benign Het
Pcdhgb6 A T 18: 37,743,001 N254I possibly damaging Het
Peli3 A T 19: 4,941,822 C30* probably null Het
Plb1 T A 5: 32,355,387 M1363K probably damaging Het
Ppp4r4 G T 12: 103,584,087 E257* probably null Het
Rbm20 T G 19: 53,851,629 S1016R probably benign Het
Rcn1 A T 2: 105,394,681 L143Q possibly damaging Het
Retreg1 G A 15: 25,940,899 G3D unknown Het
Rrm2 A G 12: 24,708,957 N65D probably benign Het
Samhd1 G T 2: 157,123,299 H199N probably damaging Het
Slain2 T A 5: 72,957,626 L400* probably null Het
Slc26a7 A T 4: 14,522,862 M486K probably benign Het
Slc30a4 A T 2: 122,694,536 Y133N probably damaging Het
Spef2 A T 15: 9,601,859 F1439Y unknown Het
Srpr T C 9: 35,211,374 V29A possibly damaging Het
St3gal1 T C 15: 67,109,650 T226A possibly damaging Het
Tas2r136 T A 6: 132,777,850 I105F probably benign Het
Tmem208 A G 8: 105,334,874 *177W probably null Het
Ttc30b A T 2: 75,938,123 Y95* probably null Het
Utrn T A 10: 12,735,177 N478I probably damaging Het
Zbtb37 T C 1: 161,031,862 Y291C probably damaging Het
Zc3h3 T G 15: 75,837,610 H470P probably benign Het
Zfp40 A T 17: 23,176,889 Y241* probably null Het
Zfp457 T C 13: 67,292,810 N567S probably benign Het
Zfp458 C T 13: 67,260,153 V33M probably damaging Het
Zfp953 A T 13: 67,343,414 I158N possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
R9059:Dsg4 UTSW 18 20471125 missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20452990 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACCAGGCCTGTATACC -3'
(R):5'- TCACTGGTCCTATACATGCATC -3'

Sequencing Primer
(F):5'- GGCCTGTATACCAATCAGCACTG -3'
(R):5'- CTGGTCCTATACATGCATCACTAATG -3'
Posted On 2022-11-14