Incidental Mutation 'R9765:Dock8'
ID 733246
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9765 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 25169468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 1437 (I1437S)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025831
AA Change: I1437S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: I1437S

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,454,829 V25I probably benign Het
Actr1b T A 1: 36,702,596 H65L probably benign Het
Adgrf5 G A 17: 43,437,600 G440E probably damaging Het
Ash1l T A 3: 89,023,193 D1992E probably damaging Het
Cacng4 A G 11: 107,741,983 F81S probably damaging Het
Cdca8 A G 4: 124,920,329 I223T probably benign Het
Cdh19 A G 1: 110,895,381 probably null Het
Ces2f A G 8: 104,950,046 D124G probably damaging Het
Cks1brt A G 8: 85,171,605 Y29C probably damaging Het
Cntnap4 T C 8: 112,757,478 S388P probably benign Het
Cntnap4 T C 8: 112,841,864 I844T probably damaging Het
Col4a3 G A 1: 82,668,957 W396* probably null Het
Cul9 A T 17: 46,539,298 S449T probably benign Het
Cux2 G A 5: 121,869,132 P822L probably benign Het
Cyp3a13 G C 5: 137,911,621 P147A probably damaging Het
Dennd2a C T 6: 39,496,973 probably null Het
Dgkg T C 16: 22,479,407 M743V possibly damaging Het
Dhx35 C T 2: 158,829,581 R311W probably benign Het
Dnase1l2 A T 17: 24,441,075 V273E probably damaging Het
Dpy19l3 T C 7: 35,708,631 D450G probably benign Het
Dsg4 G A 18: 20,471,277 V934I probably benign Het
Eef2 T A 10: 81,179,176 F236L possibly damaging Het
Eml4 A G 17: 83,440,069 I247V probably damaging Het
Evi5 A C 5: 107,799,254 C451G probably benign Het
Fam124a T G 14: 62,587,434 W126G probably damaging Het
Fbxw21 A G 9: 109,146,557 I257T possibly damaging Het
Fn3krp A G 11: 121,421,478 K6E probably benign Het
Gcn1l1 G A 5: 115,597,072 W1149* probably null Het
Glud1 C T 14: 34,338,838 R453* probably null Het
Gtf2f1 G A 17: 57,011,125 probably benign Het
Gtpbp4 T A 13: 8,974,958 D532V probably benign Het
Ifnar2 G A 16: 91,388,087 R122H possibly damaging Het
Ipo11 A G 13: 106,925,048 W35R probably damaging Het
Iqgap3 G A 3: 88,110,054 R1115Q possibly damaging Het
Kifc5b A G 17: 26,923,265 E239G probably damaging Het
Map3k7 A T 4: 32,019,519 E553D probably damaging Het
Mdh1 G T 11: 21,562,926 S146* probably null Het
Muc16 C A 9: 18,637,198 W5933L probably benign Het
Myo16 C A 8: 10,570,401 P1651T probably damaging Het
Naip5 C G 13: 100,230,761 A276P probably damaging Het
Noxo1 G T 17: 24,696,412 probably benign Het
Olfr1299 T A 2: 111,664,885 Y220N probably benign Het
Pcdhgb6 A T 18: 37,743,001 N254I possibly damaging Het
Peli3 A T 19: 4,941,822 C30* probably null Het
Plb1 T A 5: 32,355,387 M1363K probably damaging Het
Ppp4r4 G T 12: 103,584,087 E257* probably null Het
Rbm20 T G 19: 53,851,629 S1016R probably benign Het
Rcn1 A T 2: 105,394,681 L143Q possibly damaging Het
Retreg1 G A 15: 25,940,899 G3D unknown Het
Rrm2 A G 12: 24,708,957 N65D probably benign Het
Samhd1 G T 2: 157,123,299 H199N probably damaging Het
Slain2 T A 5: 72,957,626 L400* probably null Het
Slc26a7 A T 4: 14,522,862 M486K probably benign Het
Slc30a4 A T 2: 122,694,536 Y133N probably damaging Het
Spef2 A T 15: 9,601,859 F1439Y unknown Het
Srpr T C 9: 35,211,374 V29A possibly damaging Het
St3gal1 T C 15: 67,109,650 T226A possibly damaging Het
Tas2r136 T A 6: 132,777,850 I105F probably benign Het
Tmem208 A G 8: 105,334,874 *177W probably null Het
Ttc30b A T 2: 75,938,123 Y95* probably null Het
Utrn T A 10: 12,735,177 N478I probably damaging Het
Zbtb37 T C 1: 161,031,862 Y291C probably damaging Het
Zc3h3 T G 15: 75,837,610 H470P probably benign Het
Zfp40 A T 17: 23,176,889 Y241* probably null Het
Zfp457 T C 13: 67,292,810 N567S probably benign Het
Zfp458 C T 13: 67,260,153 V33M probably damaging Het
Zfp953 A T 13: 67,343,414 I158N possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25183631 splice site probably benign
R9509:Dock8 UTSW 19 25095621 missense probably benign 0.00
R9526:Dock8 UTSW 19 25188375 missense probably benign 0.10
R9622:Dock8 UTSW 19 25121181 missense probably null
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
R9654:Dock8 UTSW 19 25147346 missense probably damaging 1.00
R9670:Dock8 UTSW 19 25171562 missense probably null 0.01
R9699:Dock8 UTSW 19 25156024 critical splice donor site probably null
R9726:Dock8 UTSW 19 25177010 missense probably damaging 0.97
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACACCTTCAGCCCTGAGATTG -3'
(R):5'- TGCAAATTCCAAACGTTCCC -3'

Sequencing Primer
(F):5'- GCTATGTTGAGGTGGCCAC -3'
(R):5'- AATTCCAAACGTTCCCACTTTAG -3'
Posted On 2022-11-14