Incidental Mutation 'R9766:Scn11a'
ID 733288
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9766 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119584181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 1478 (N1478T)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: N1478T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: N1478T

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: N1478T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,385,788 (GRCm39) V59A probably benign Het
Aatk A T 11: 119,902,565 (GRCm39) H610Q probably benign Het
Acox1 G A 11: 116,071,867 (GRCm39) A187V probably damaging Het
Acsbg3 A G 17: 57,189,177 (GRCm39) Y195C probably benign Het
AI661453 C T 17: 47,757,570 (GRCm39) R76W probably damaging Het
Anapc1 C T 2: 128,500,221 (GRCm39) R808Q probably damaging Het
Ankrd26 T C 6: 118,500,067 (GRCm39) T1135A possibly damaging Het
Arhgap17 A G 7: 122,921,148 (GRCm39) V113A probably benign Het
Art3 T C 5: 92,562,138 (GRCm39) C379R unknown Het
Bltp3a T C 17: 28,105,799 (GRCm39) L775P probably damaging Het
Bmp5 A G 9: 75,800,982 (GRCm39) I371V probably damaging Het
Ccdc88b T A 19: 6,833,096 (GRCm39) E281V probably damaging Het
Ces1e A T 8: 93,946,031 (GRCm39) Y171N probably damaging Het
Cib3 A T 8: 72,961,034 (GRCm39) F68I possibly damaging Het
Crtac1 A T 19: 42,402,557 (GRCm39) L17Q possibly damaging Het
Crybg3 A T 16: 59,376,207 (GRCm39) S1682R probably benign Het
Ddx60 G A 8: 62,465,312 (GRCm39) G1323D probably damaging Het
Dock3 A C 9: 106,788,483 (GRCm39) D161E probably benign Het
Dpep3 A C 8: 106,705,369 (GRCm39) L127R probably damaging Het
Dus2 A G 8: 106,772,568 (GRCm39) D226G probably damaging Het
Ebna1bp2 T C 4: 118,480,821 (GRCm39) V184A possibly damaging Het
Edem1 T A 6: 108,823,648 (GRCm39) I348N probably damaging Het
Efcab8 A T 2: 153,656,362 (GRCm39) M599L unknown Het
Eif2ak4 A T 2: 118,261,313 (GRCm39) K618* probably null Het
Fbxw27 T C 9: 109,602,215 (GRCm39) K253E possibly damaging Het
Fgf5 A G 5: 98,423,113 (GRCm39) E166G possibly damaging Het
Flot1 G T 17: 36,141,555 (GRCm39) E321* probably null Het
Gm14443 T C 2: 175,012,248 (GRCm39) E66G probably benign Het
Gprc6a G A 10: 51,491,884 (GRCm39) P622S probably damaging Het
Gsta2 A T 9: 78,244,876 (GRCm39) Y79* probably null Het
Hecw2 A G 1: 53,904,287 (GRCm39) S1154P probably damaging Het
Hrob A T 11: 102,146,586 (GRCm39) Q287H possibly damaging Het
Kcnd2 T C 6: 21,216,367 (GRCm39) S24P probably benign Het
Knl1 A G 2: 118,900,381 (GRCm39) D694G probably damaging Het
L1td1 T C 4: 98,624,753 (GRCm39) I316T probably benign Het
Lrsam1 G T 2: 32,818,077 (GRCm39) Q660K probably benign Het
Muc16 T A 9: 18,548,153 (GRCm39) T6047S probably benign Het
Muc16 T A 9: 18,552,383 (GRCm39) T4637S probably benign Het
Myo5a T C 9: 75,078,914 (GRCm39) Y891H probably damaging Het
Nkd2 G T 13: 73,995,131 (GRCm39) D22E possibly damaging Het
Patl2 A T 2: 121,954,212 (GRCm39) V453E probably damaging Het
Pcnx2 A G 8: 126,488,313 (GRCm39) Y1744H probably damaging Het
Phf8-ps T G 17: 33,285,647 (GRCm39) N385T probably damaging Het
Pira2 T A 7: 3,845,517 (GRCm39) H289L possibly damaging Het
Pitpnm1 T C 19: 4,158,117 (GRCm39) I569T probably benign Het
Ppp4r4 T C 12: 103,562,735 (GRCm39) V568A probably benign Het
Ptf1a G A 2: 19,451,062 (GRCm39) G131S probably benign Het
Rasgrf2 G T 13: 92,160,188 (GRCm39) H396N probably damaging Het
Rfx1 C T 8: 84,814,376 (GRCm39) T315M probably damaging Het
Rnf207 C A 4: 152,400,402 (GRCm39) R148L probably damaging Het
Sdr39u1 C T 14: 56,135,194 (GRCm39) V250I probably benign Het
Serinc3 T C 2: 163,471,095 (GRCm39) T276A probably damaging Het
Speer4a3 AACT A 5: 26,155,849 (GRCm39) probably benign Het
Stambp C A 6: 83,534,469 (GRCm39) A273S probably benign Het
Taf2 T C 15: 54,910,881 (GRCm39) probably null Het
Tex26 A T 5: 149,386,642 (GRCm39) Y232F probably damaging Het
Tmem258 T C 19: 10,184,578 (GRCm39) L55P probably damaging Het
Trappc8 A G 18: 20,979,630 (GRCm39) I755T possibly damaging Het
Ubr4 T C 4: 139,194,595 (GRCm39) Y1163H unknown Het
Usp14 G A 18: 10,005,630 (GRCm39) T254I probably benign Het
Vcan A G 13: 89,839,247 (GRCm39) L2099P probably benign Het
Wdfy3 C T 5: 102,042,866 (GRCm39) V1962I possibly damaging Het
Zfp407 T C 18: 84,577,574 (GRCm39) T1180A probably benign Het
Zfp644 C A 5: 106,784,691 (GRCm39) G619C probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATTCCAGCATGGGGTTGAG -3'
(R):5'- GAAGCTGCAGTGCATGTTG -3'

Sequencing Primer
(F):5'- CATGGGGTTGAGGAGAGCATC -3'
(R):5'- CAGTGCATGTTGGGAACTCAC -3'
Posted On 2022-11-14