Incidental Mutation 'R9766:Gprc6a'
ID 733289
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9766 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51615788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 622 (P622S)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: P622S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: P622S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218684
AA Change: P447S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: P551S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,177 Y195C probably benign Het
3425401B19Rik A G 14: 32,663,831 V59A probably benign Het
4921501E09Rik T G 17: 33,066,673 N385T probably damaging Het
Aatk A T 11: 120,011,739 H610Q probably benign Het
Acox1 G A 11: 116,181,041 A187V probably damaging Het
AI661453 C T 17: 47,446,645 R76W probably damaging Het
Anapc1 C T 2: 128,658,301 R808Q probably damaging Het
Ankrd26 T C 6: 118,523,106 T1135A possibly damaging Het
Arhgap17 A G 7: 123,321,925 V113A probably benign Het
Art3 T C 5: 92,414,279 C379R unknown Het
BC030867 A T 11: 102,255,760 Q287H possibly damaging Het
Bmp5 A G 9: 75,893,700 I371V probably damaging Het
Ccdc88b T A 19: 6,855,728 E281V probably damaging Het
Ces1e A T 8: 93,219,403 Y171N probably damaging Het
Cib3 A T 8: 72,207,190 F68I possibly damaging Het
Crtac1 A T 19: 42,414,118 L17Q possibly damaging Het
Crybg3 A T 16: 59,555,844 S1682R probably benign Het
Ddx60 G A 8: 62,012,278 G1323D probably damaging Het
Dock3 A C 9: 106,911,284 D161E probably benign Het
Dpep3 A C 8: 105,978,737 L127R probably damaging Het
Dus2 A G 8: 106,045,936 D226G probably damaging Het
Ebna1bp2 T C 4: 118,623,624 V184A possibly damaging Het
Edem1 T A 6: 108,846,687 I348N probably damaging Het
Efcab8 A T 2: 153,814,442 M599L unknown Het
Eif2ak4 A T 2: 118,430,832 K618* probably null Het
Fbxw27 T C 9: 109,773,147 K253E possibly damaging Het
Fgf5 A G 5: 98,275,254 E166G possibly damaging Het
Flot1 G T 17: 35,830,663 E321* probably null Het
Gm14443 T C 2: 175,170,455 E66G probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gsta2 A T 9: 78,337,594 Y79* probably null Het
Hecw2 A G 1: 53,865,128 S1154P probably damaging Het
Kcnd2 T C 6: 21,216,368 S24P probably benign Het
Knl1 A G 2: 119,069,900 D694G probably damaging Het
L1td1 T C 4: 98,736,516 I316T probably benign Het
Lrsam1 G T 2: 32,928,065 Q660K probably benign Het
Muc16 T A 9: 18,636,857 T6047S probably benign Het
Muc16 T A 9: 18,641,087 T4637S probably benign Het
Myo5a T C 9: 75,171,632 Y891H probably damaging Het
Nkd2 G T 13: 73,847,012 D22E possibly damaging Het
Patl2 A T 2: 122,123,731 V453E probably damaging Het
Pcnx2 A G 8: 125,761,574 Y1744H probably damaging Het
Pira2 T A 7: 3,842,518 H289L possibly damaging Het
Pitpnm1 T C 19: 4,108,117 I569T probably benign Het
Ppp4r4 T C 12: 103,596,476 V568A probably benign Het
Ptf1a G A 2: 19,446,251 G131S probably benign Het
Rasgrf2 G T 13: 92,023,680 H396N probably damaging Het
Rfx1 C T 8: 84,087,747 T315M probably damaging Het
Rnf207 C A 4: 152,315,945 R148L probably damaging Het
Scn11a T G 9: 119,755,115 N1478T probably damaging Het
Sdr39u1 C T 14: 55,897,737 V250I probably benign Het
Serinc3 T C 2: 163,629,175 T276A probably damaging Het
Stambp C A 6: 83,557,487 A273S probably benign Het
Taf2 T C 15: 55,047,485 probably null Het
Tex26 A T 5: 149,463,177 Y232F probably damaging Het
Tmem258 T C 19: 10,207,214 L55P probably damaging Het
Trappc8 A G 18: 20,846,573 I755T possibly damaging Het
Ubr4 T C 4: 139,467,284 Y1163H unknown Het
Uhrf1bp1 T C 17: 27,886,825 L775P probably damaging Het
Usp14 G A 18: 10,005,630 T254I probably benign Het
Vcan A G 13: 89,691,128 L2099P probably benign Het
Wdfy3 C T 5: 101,895,000 V1962I possibly damaging Het
Zfp407 T C 18: 84,559,449 T1180A probably benign Het
Zfp644 C A 5: 106,636,825 G619C probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGCTTGGGGTCAAAACTG -3'
(R):5'- CTGCCTTTTATGCAACAATGAAACC -3'

Sequencing Primer
(F):5'- GCTAGCAAAATTTTCAGGGACTTGG -3'
(R):5'- TTTATGCAACAATGAAACCCACTGG -3'
Posted On 2022-11-14