Incidental Mutation 'R9767:Speg'
ID 733317
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9767 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75427181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2669 (I2669F)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: I2669F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: I2669F

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A T 3: 151,501,757 (GRCm38) M314L probably benign Het
Ank3 T C 10: 69,987,969 (GRCm38) S41P probably damaging Het
Aox4 A C 1: 58,235,198 (GRCm38) N381T probably benign Het
Bnip3l G A 14: 67,008,765 (GRCm38) P7L possibly damaging Het
Bpifb6 G A 2: 153,909,228 (GRCm38) probably null Het
Cep350 A G 1: 155,863,272 (GRCm38) V2275A probably benign Het
Cntn4 G A 6: 106,678,434 (GRCm38) G831E probably benign Het
D6Ertd527e G C 6: 87,111,857 (GRCm38) S334T unknown Het
Dchs2 A G 3: 83,304,899 (GRCm38) I2002V probably benign Het
Dennd2a G A 6: 39,506,775 (GRCm38) R384C probably damaging Het
Dock1 A G 7: 134,741,067 (GRCm38) T136A possibly damaging Het
Eif2s2 A T 2: 154,888,205 (GRCm38) D57E probably benign Het
Eml2 C T 7: 19,186,158 (GRCm38) T129I probably benign Het
Flad1 A C 3: 89,403,411 (GRCm38) I443S probably benign Het
Glis1 A T 4: 107,634,597 (GRCm38) T741S probably benign Het
Gpr156 A G 16: 37,997,935 (GRCm38) Y331C probably damaging Het
Lrwd1 C T 5: 136,134,002 (GRCm38) V122M possibly damaging Het
Ndufs2 G T 1: 171,241,074 (GRCm38) P89Q probably damaging Het
Nkx1-2 C T 7: 132,597,673 (GRCm38) V120I probably benign Het
Olfr721-ps1 C T 14: 14,407,929 (GRCm38) R234W probably damaging Het
Or7a41 T C 10: 79,034,931 (GRCm38) L45P possibly damaging Het
Pcdhga3 T A 18: 37,675,043 (GRCm38) I183N probably benign Het
Pkhd1 T C 1: 20,414,412 (GRCm38) D1973G probably benign Het
Ppp1r3a A G 6: 14,718,102 (GRCm38) S938P probably benign Het
Prss27 G T 17: 24,038,309 (GRCm38) M1I probably null Het
Rai14 T C 15: 10,610,041 (GRCm38) T74A probably benign Het
Rcc2 C T 4: 140,708,020 (GRCm38) R117W probably damaging Het
Rpl31 T A 1: 39,371,108 (GRCm38) *130R probably null Het
Rplp0 T C 5: 115,561,504 (GRCm38) S213P probably benign Het
Sdcbp2 T C 2: 151,587,137 (GRCm38) I152T probably damaging Het
Senp3 T C 11: 69,678,187 (GRCm38) T383A possibly damaging Het
Sod2 C A 17: 13,008,293 (GRCm38) Q45K probably benign Het
Stat4 T G 1: 52,102,494 (GRCm38) F577V probably damaging Het
Tex9 C A 9: 72,461,236 (GRCm38) E377* probably null Het
Tmprss15 A T 16: 79,079,089 (GRCm38) V119D probably damaging Het
Unc79 T C 12: 103,112,975 (GRCm38) S1800P probably benign Het
Vldlr A G 19: 27,234,874 (GRCm38) D96G probably damaging Het
Vmn2r51 G T 7: 10,105,480 (GRCm38) N60K probably benign Het
Vps13b A G 15: 35,910,257 (GRCm38) D3389G probably damaging Het
Vps13d C T 4: 145,152,736 (GRCm38) E1506K Het
Zfp1 A G 8: 111,669,571 (GRCm38) N75D probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,410,390 (GRCm38) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,410,734 (GRCm38) missense probably damaging 0.98
IGL01122:Speg APN 1 75,410,035 (GRCm38) missense probably damaging 1.00
IGL01293:Speg APN 1 75,388,102 (GRCm38) missense probably damaging 1.00
IGL01304:Speg APN 1 75,428,197 (GRCm38) missense probably benign 0.00
IGL01351:Speg APN 1 75,411,276 (GRCm38) splice site probably benign
IGL01473:Speg APN 1 75,428,285 (GRCm38) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,391,897 (GRCm38) missense probably damaging 1.00
IGL01485:Speg APN 1 75,387,827 (GRCm38) missense probably damaging 1.00
IGL01584:Speg APN 1 75,430,937 (GRCm38) missense probably damaging 1.00
IGL01959:Speg APN 1 75,391,090 (GRCm38) missense probably damaging 1.00
IGL02231:Speg APN 1 75,423,387 (GRCm38) missense probably damaging 1.00
IGL02355:Speg APN 1 75,423,915 (GRCm38) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,423,915 (GRCm38) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,431,279 (GRCm38) missense probably damaging 0.97
IGL03168:Speg APN 1 75,388,187 (GRCm38) missense probably damaging 1.00
H8562:Speg UTSW 1 75,415,597 (GRCm38) missense probably benign 0.39
R0112:Speg UTSW 1 75,385,032 (GRCm38) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,430,937 (GRCm38) missense probably damaging 1.00
R0315:Speg UTSW 1 75,415,136 (GRCm38) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,423,924 (GRCm38) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,430,784 (GRCm38) splice site probably benign
R0483:Speg UTSW 1 75,385,032 (GRCm38) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,427,978 (GRCm38) missense probably benign
R0683:Speg UTSW 1 75,429,118 (GRCm38) missense probably damaging 1.00
R0800:Speg UTSW 1 75,423,489 (GRCm38) missense probably damaging 1.00
R0815:Speg UTSW 1 75,415,392 (GRCm38) missense probably damaging 1.00
R0835:Speg UTSW 1 75,375,674 (GRCm38) missense probably benign 0.00
R0866:Speg UTSW 1 75,417,083 (GRCm38) missense probably damaging 0.99
R0880:Speg UTSW 1 75,405,061 (GRCm38) missense probably damaging 1.00
R1082:Speg UTSW 1 75,415,138 (GRCm38) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,429,095 (GRCm38) missense probably damaging 1.00
R1252:Speg UTSW 1 75,427,095 (GRCm38) missense probably damaging 1.00
R1301:Speg UTSW 1 75,401,501 (GRCm38) missense probably damaging 1.00
R1348:Speg UTSW 1 75,422,872 (GRCm38) missense probably damaging 0.99
R1388:Speg UTSW 1 75,430,460 (GRCm38) missense probably damaging 0.99
R1465:Speg UTSW 1 75,428,484 (GRCm38) splice site probably benign
R1505:Speg UTSW 1 75,375,542 (GRCm38) missense probably benign 0.02
R1506:Speg UTSW 1 75,417,663 (GRCm38) missense probably benign 0.03
R1531:Speg UTSW 1 75,401,222 (GRCm38) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,421,951 (GRCm38) missense probably damaging 1.00
R1567:Speg UTSW 1 75,428,047 (GRCm38) missense probably benign
R1630:Speg UTSW 1 75,422,977 (GRCm38) missense probably damaging 1.00
R1667:Speg UTSW 1 75,410,549 (GRCm38) splice site probably benign
R1673:Speg UTSW 1 75,411,163 (GRCm38) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,421,744 (GRCm38) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,417,863 (GRCm38) missense probably benign 0.00
R1719:Speg UTSW 1 75,417,863 (GRCm38) missense probably benign 0.00
R1759:Speg UTSW 1 75,401,162 (GRCm38) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,389,005 (GRCm38) missense probably damaging 1.00
R1874:Speg UTSW 1 75,423,906 (GRCm38) missense probably benign
R1936:Speg UTSW 1 75,431,408 (GRCm38) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,417,727 (GRCm38) missense probably damaging 1.00
R2204:Speg UTSW 1 75,430,477 (GRCm38) missense probably benign 0.30
R2287:Speg UTSW 1 75,430,465 (GRCm38) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,406,926 (GRCm38) missense probably benign 0.27
R2983:Speg UTSW 1 75,384,930 (GRCm38) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,422,682 (GRCm38) nonsense probably null
R3112:Speg UTSW 1 75,422,682 (GRCm38) nonsense probably null
R3154:Speg UTSW 1 75,401,542 (GRCm38) missense probably damaging 1.00
R3720:Speg UTSW 1 75,426,782 (GRCm38) missense probably damaging 1.00
R3983:Speg UTSW 1 75,422,547 (GRCm38) missense probably benign 0.27
R4133:Speg UTSW 1 75,427,904 (GRCm38) missense probably benign
R4522:Speg UTSW 1 75,428,330 (GRCm38) missense probably damaging 1.00
R4564:Speg UTSW 1 75,391,834 (GRCm38) missense probably damaging 1.00
R4577:Speg UTSW 1 75,415,395 (GRCm38) missense probably damaging 1.00
R4858:Speg UTSW 1 75,421,735 (GRCm38) missense probably damaging 1.00
R4953:Speg UTSW 1 75,423,864 (GRCm38) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,427,703 (GRCm38) missense probably damaging 1.00
R4967:Speg UTSW 1 75,387,869 (GRCm38) missense probably damaging 1.00
R5152:Speg UTSW 1 75,428,098 (GRCm38) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,428,087 (GRCm38) missense probably damaging 0.99
R5371:Speg UTSW 1 75,431,393 (GRCm38) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,429,100 (GRCm38) missense probably damaging 1.00
R5562:Speg UTSW 1 75,427,056 (GRCm38) missense probably damaging 1.00
R5687:Speg UTSW 1 75,419,129 (GRCm38) splice site probably null
R5985:Speg UTSW 1 75,406,684 (GRCm38) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,415,603 (GRCm38) nonsense probably null
R6038:Speg UTSW 1 75,418,459 (GRCm38) critical splice donor site probably null
R6038:Speg UTSW 1 75,418,459 (GRCm38) critical splice donor site probably null
R6143:Speg UTSW 1 75,414,387 (GRCm38) missense probably damaging 1.00
R6265:Speg UTSW 1 75,406,679 (GRCm38) nonsense probably null
R6347:Speg UTSW 1 75,426,875 (GRCm38) missense probably benign 0.00
R6453:Speg UTSW 1 75,417,972 (GRCm38) missense probably benign 0.06
R6505:Speg UTSW 1 75,429,523 (GRCm38) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,406,684 (GRCm38) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,422,757 (GRCm38) missense probably benign 0.03
R6566:Speg UTSW 1 75,388,463 (GRCm38) missense probably damaging 1.00
R6747:Speg UTSW 1 75,410,395 (GRCm38) critical splice donor site probably null
R6819:Speg UTSW 1 75,391,812 (GRCm38) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,417,903 (GRCm38) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,387,908 (GRCm38) nonsense probably null
R6981:Speg UTSW 1 75,430,913 (GRCm38) missense probably damaging 1.00
R7002:Speg UTSW 1 75,423,268 (GRCm38) missense probably damaging 0.98
R7082:Speg UTSW 1 75,411,447 (GRCm38) missense probably damaging 0.96
R7140:Speg UTSW 1 75,406,770 (GRCm38) critical splice donor site probably null
R7175:Speg UTSW 1 75,422,490 (GRCm38) missense probably benign 0.01
R7178:Speg UTSW 1 75,422,383 (GRCm38) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,384,835 (GRCm38) missense probably damaging 0.97
R7420:Speg UTSW 1 75,430,905 (GRCm38) missense probably damaging 1.00
R7537:Speg UTSW 1 75,401,464 (GRCm38) missense probably damaging 1.00
R7562:Speg UTSW 1 75,431,279 (GRCm38) missense probably damaging 0.97
R7615:Speg UTSW 1 75,429,242 (GRCm38) missense probably damaging 1.00
R7679:Speg UTSW 1 75,406,315 (GRCm38) missense probably damaging 1.00
R7692:Speg UTSW 1 75,401,190 (GRCm38) missense probably benign 0.04
R7696:Speg UTSW 1 75,429,161 (GRCm38) missense probably damaging 1.00
R7719:Speg UTSW 1 75,375,825 (GRCm38) missense probably damaging 1.00
R7794:Speg UTSW 1 75,388,870 (GRCm38) missense probably benign 0.00
R7824:Speg UTSW 1 75,384,017 (GRCm38) splice site probably null
R7834:Speg UTSW 1 75,384,927 (GRCm38) missense probably damaging 1.00
R7892:Speg UTSW 1 75,427,166 (GRCm38) missense probably damaging 1.00
R8015:Speg UTSW 1 75,415,421 (GRCm38) splice site probably benign
R8068:Speg UTSW 1 75,422,250 (GRCm38) missense probably damaging 1.00
R8085:Speg UTSW 1 75,415,353 (GRCm38) missense probably damaging 1.00
R8130:Speg UTSW 1 75,415,596 (GRCm38) missense probably damaging 1.00
R8132:Speg UTSW 1 75,422,995 (GRCm38) missense probably damaging 1.00
R8239:Speg UTSW 1 75,419,033 (GRCm38) missense probably damaging 1.00
R8287:Speg UTSW 1 75,422,236 (GRCm38) missense probably benign 0.26
R8299:Speg UTSW 1 75,387,836 (GRCm38) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,411,332 (GRCm38) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,431,309 (GRCm38) missense probably damaging 1.00
R8555:Speg UTSW 1 75,402,264 (GRCm38) splice site probably null
R8781:Speg UTSW 1 75,407,021 (GRCm38) missense probably damaging 1.00
R8784:Speg UTSW 1 75,405,149 (GRCm38) critical splice donor site probably benign
R8848:Speg UTSW 1 75,427,438 (GRCm38) critical splice donor site probably null
R8881:Speg UTSW 1 75,401,151 (GRCm38) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,388,873 (GRCm38) missense probably damaging 1.00
R8935:Speg UTSW 1 75,422,606 (GRCm38) missense probably benign 0.30
R9019:Speg UTSW 1 75,429,238 (GRCm38) missense probably damaging 1.00
R9027:Speg UTSW 1 75,388,432 (GRCm38) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,385,010 (GRCm38) missense probably damaging 0.99
R9092:Speg UTSW 1 75,422,734 (GRCm38) missense probably benign 0.01
R9117:Speg UTSW 1 75,387,800 (GRCm38) missense probably damaging 1.00
R9202:Speg UTSW 1 75,390,993 (GRCm38) missense probably damaging 1.00
R9246:Speg UTSW 1 75,384,854 (GRCm38) missense probably damaging 1.00
R9248:Speg UTSW 1 75,421,776 (GRCm38) missense probably damaging 1.00
R9451:Speg UTSW 1 75,417,733 (GRCm38) missense probably damaging 1.00
R9452:Speg UTSW 1 75,422,508 (GRCm38) missense probably benign
R9475:Speg UTSW 1 75,388,091 (GRCm38) missense probably damaging 1.00
R9476:Speg UTSW 1 75,401,124 (GRCm38) missense probably damaging 0.99
R9510:Speg UTSW 1 75,401,124 (GRCm38) missense probably damaging 0.99
R9519:Speg UTSW 1 75,415,736 (GRCm38) missense probably damaging 1.00
R9528:Speg UTSW 1 75,387,803 (GRCm38) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,422,782 (GRCm38) missense probably benign 0.08
R9553:Speg UTSW 1 75,418,001 (GRCm38) missense probably benign 0.00
R9768:Speg UTSW 1 75,418,973 (GRCm38) nonsense probably null
R9800:Speg UTSW 1 75,422,714 (GRCm38) missense probably benign 0.03
X0025:Speg UTSW 1 75,422,457 (GRCm38) missense probably damaging 1.00
X0026:Speg UTSW 1 75,423,475 (GRCm38) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,406,594 (GRCm38) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,427,683 (GRCm38) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,430,455 (GRCm38) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,428,381 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGCTGCTCCGTCTATG -3'
(R):5'- AGAGTGTATGTGCAAGGTGC -3'

Sequencing Primer
(F):5'- ATGCCTTCTTGTCCCCAGATAAG -3'
(R):5'- TATGTGCAAGGTGCCCGAC -3'
Posted On 2022-11-14