Incidental Mutation 'R9767:Glis1'
ID 733326
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9767 (G1)
Quality Score 205.009
Status Not validated
Chromosome 4
Chromosomal Location 107434591-107635061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107634597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 741 (T741S)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
AlphaFold Q8K1M4
Predicted Effect probably benign
Transcript: ENSMUST00000046005
AA Change: T741S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: T741S

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106738
AA Change: T553S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: T553S

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A T 3: 151,501,757 M314L probably benign Het
Ank3 T C 10: 69,987,969 S41P probably damaging Het
Aox4 A C 1: 58,235,198 N381T probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Bpifb6 G A 2: 153,909,228 probably null Het
Cep350 A G 1: 155,863,272 V2275A probably benign Het
Cntn4 G A 6: 106,678,434 G831E probably benign Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dchs2 A G 3: 83,304,899 I2002V probably benign Het
Dennd2a G A 6: 39,506,775 R384C probably damaging Het
Dock1 A G 7: 134,741,067 T136A possibly damaging Het
Eif2s2 A T 2: 154,888,205 D57E probably benign Het
Eml2 C T 7: 19,186,158 T129I probably benign Het
Flad1 A C 3: 89,403,411 I443S probably benign Het
Gpr156 A G 16: 37,997,935 Y331C probably damaging Het
Lrwd1 C T 5: 136,134,002 V122M possibly damaging Het
Ndufs2 G T 1: 171,241,074 P89Q probably damaging Het
Nkx1-2 C T 7: 132,597,673 V120I probably benign Het
Olfr57 T C 10: 79,034,931 L45P possibly damaging Het
Olfr721-ps1 C T 14: 14,407,929 R234W probably damaging Het
Pcdhga3 T A 18: 37,675,043 I183N probably benign Het
Pkhd1 T C 1: 20,414,412 D1973G probably benign Het
Ppp1r3a A G 6: 14,718,102 S938P probably benign Het
Prss27 G T 17: 24,038,309 M1I probably null Het
Rai14 T C 15: 10,610,041 T74A probably benign Het
Rcc2 C T 4: 140,708,020 R117W probably damaging Het
Rpl31 T A 1: 39,371,108 *130R probably null Het
Rplp0 T C 5: 115,561,504 S213P probably benign Het
Sdcbp2 T C 2: 151,587,137 I152T probably damaging Het
Senp3 T C 11: 69,678,187 T383A possibly damaging Het
Sod2 C A 17: 13,008,293 Q45K probably benign Het
Speg A T 1: 75,427,181 I2669F possibly damaging Het
Stat4 T G 1: 52,102,494 F577V probably damaging Het
Tex9 C A 9: 72,461,236 E377* probably null Het
Tmprss15 A T 16: 79,079,089 V119D probably damaging Het
Unc79 T C 12: 103,112,975 S1800P probably benign Het
Vldlr A G 19: 27,234,874 D96G probably damaging Het
Vmn2r51 G T 7: 10,105,480 N60K probably benign Het
Vps13b A G 15: 35,910,257 D3389G probably damaging Het
Vps13d C T 4: 145,152,736 E1506K Het
Zfp1 A G 8: 111,669,571 N75D probably benign Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107627561 missense probably benign 0.01
IGL02450:Glis1 APN 4 107627529 missense probably benign 0.25
IGL03167:Glis1 APN 4 107435905 missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107615051 missense probably damaging 1.00
IGL03377:Glis1 APN 4 107632281 missense probably damaging 0.98
glenys UTSW 4 107627543 missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107568119 splice site probably null
R0981:Glis1 UTSW 4 107615042 missense probably damaging 1.00
R1036:Glis1 UTSW 4 107632264 missense probably benign 0.05
R1527:Glis1 UTSW 4 107567926 missense probably damaging 0.96
R1741:Glis1 UTSW 4 107568347 missense probably damaging 1.00
R2937:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107567845 missense probably benign 0.01
R4412:Glis1 UTSW 4 107634718 missense probably damaging 0.99
R4587:Glis1 UTSW 4 107627543 missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107567645 missense probably benign 0.00
R4900:Glis1 UTSW 4 107619564 missense probably damaging 1.00
R5138:Glis1 UTSW 4 107623105 frame shift probably null
R5167:Glis1 UTSW 4 107634694 missense probably damaging 1.00
R5511:Glis1 UTSW 4 107435877 missense probably damaging 0.99
R5568:Glis1 UTSW 4 107619635 missense probably damaging 0.99
R5807:Glis1 UTSW 4 107568082 missense probably benign 0.00
R6006:Glis1 UTSW 4 107567906 missense probably damaging 1.00
R6180:Glis1 UTSW 4 107627513 missense probably benign 0.06
R6219:Glis1 UTSW 4 107631905 missense probably benign 0.27
R6856:Glis1 UTSW 4 107435879 missense probably damaging 0.96
R7278:Glis1 UTSW 4 107435683 start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107634703 missense probably damaging 1.00
R7937:Glis1 UTSW 4 107627526 missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107632374 missense probably damaging 1.00
R7940:Glis1 UTSW 4 107632375 missense probably damaging 0.99
R7954:Glis1 UTSW 4 107619657 missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107567902 missense probably damaging 1.00
R8931:Glis1 UTSW 4 107563863 missense probably benign 0.35
R9227:Glis1 UTSW 4 107568130 missense probably benign 0.45
R9230:Glis1 UTSW 4 107568130 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AAGCCAGTCTGCCTGTCTTC -3'
(R):5'- TGTGATTTGAGAACCTTATGGAGAG -3'

Sequencing Primer
(F):5'- AGTCTGCCTGTCTTCCCAGC -3'
(R):5'- AGCCCTCCAGGTAGGGAAGTAC -3'
Posted On 2022-11-14