Incidental Mutation 'R9767:Vmn2r51'
ID 733335
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9767 (G1)
Quality Score 172.009
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 9839407 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 60 (N60K)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably benign
Transcript: ENSMUST00000094863
AA Change: N60K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: N60K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A T 3: 151,207,394 (GRCm39) M314L probably benign Het
Ank3 T C 10: 69,823,799 (GRCm39) S41P probably damaging Het
Aox4 A C 1: 58,274,357 (GRCm39) N381T probably benign Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Bpifb6 G A 2: 153,751,148 (GRCm39) probably null Het
Cep350 A G 1: 155,739,018 (GRCm39) V2275A probably benign Het
Cntn4 G A 6: 106,655,395 (GRCm39) G831E probably benign Het
D6Ertd527e G C 6: 87,088,839 (GRCm39) S334T unknown Het
Dchs2 A G 3: 83,212,206 (GRCm39) I2002V probably benign Het
Dennd2a G A 6: 39,483,709 (GRCm39) R384C probably damaging Het
Dock1 A G 7: 134,342,796 (GRCm39) T136A possibly damaging Het
Eif2s2 A T 2: 154,730,125 (GRCm39) D57E probably benign Het
Eml2 C T 7: 18,920,083 (GRCm39) T129I probably benign Het
Flad1 A C 3: 89,310,718 (GRCm39) I443S probably benign Het
Glis1 A T 4: 107,491,794 (GRCm39) T741S probably benign Het
Gpr156 A G 16: 37,818,297 (GRCm39) Y331C probably damaging Het
Lrwd1 C T 5: 136,162,856 (GRCm39) V122M possibly damaging Het
Ndufs2 G T 1: 171,068,643 (GRCm39) P89Q probably damaging Het
Nkx1-2 C T 7: 132,199,402 (GRCm39) V120I probably benign Het
Or2t35 C T 14: 14,407,929 (GRCm38) R234W probably damaging Het
Or7a41 T C 10: 78,870,765 (GRCm39) L45P possibly damaging Het
Pcdhga3 T A 18: 37,808,096 (GRCm39) I183N probably benign Het
Pkhd1 T C 1: 20,484,636 (GRCm39) D1973G probably benign Het
Ppp1r3a A G 6: 14,718,101 (GRCm39) S938P probably benign Het
Prss27 G T 17: 24,257,283 (GRCm39) M1I probably null Het
Rai14 T C 15: 10,610,127 (GRCm39) T74A probably benign Het
Rcc2 C T 4: 140,435,331 (GRCm39) R117W probably damaging Het
Rpl31 T A 1: 39,410,189 (GRCm39) *130R probably null Het
Rplp0 T C 5: 115,699,563 (GRCm39) S213P probably benign Het
Sdcbp2 T C 2: 151,429,057 (GRCm39) I152T probably damaging Het
Senp3 T C 11: 69,569,013 (GRCm39) T383A possibly damaging Het
Sod2 C A 17: 13,227,180 (GRCm39) Q45K probably benign Het
Speg A T 1: 75,403,825 (GRCm39) I2669F possibly damaging Het
Stat4 T G 1: 52,141,653 (GRCm39) F577V probably damaging Het
Tex9 C A 9: 72,368,518 (GRCm39) E377* probably null Het
Tmprss15 A T 16: 78,875,977 (GRCm39) V119D probably damaging Het
Unc79 T C 12: 103,079,234 (GRCm39) S1800P probably benign Het
Vldlr A G 19: 27,212,274 (GRCm39) D96G probably damaging Het
Vps13b A G 15: 35,910,403 (GRCm39) D3389G probably damaging Het
Vps13d C T 4: 144,879,306 (GRCm39) E1506K Het
Zfp1 A G 8: 112,396,203 (GRCm39) N75D probably benign Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AATCAGAAGCCACCTGGAAG -3'
(R):5'- ACACTGCCCAGGTTTAAGGC -3'

Sequencing Primer
(F):5'- CCTCCACTGGATTAATTAAATGGAG -3'
(R):5'- GGCAGGAAAAATATGTTCGTTTTC -3'
Posted On 2022-11-14