Incidental Mutation 'R9768:Nipal4'
ID 733375
Institutional Source Beutler Lab
Gene Symbol Nipal4
Ensembl Gene ENSMUSG00000020411
Gene Name NIPA-like domain containing 4
Synonyms 9530066K23Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9768 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 46038982-46057186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46041473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000020679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400] [ENSMUST00000020679]
AlphaFold Q8BZF2
Predicted Effect probably benign
Transcript: ENSMUST00000011400
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000020679
AA Change: V241M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020679
Gene: ENSMUSG00000020411
AA Change: V241M

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 56 350 1.6e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144915
Meta Mutation Damage Score 0.6921 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a membrane receptor. Mutations in this gene have been associated with autosomal recessive congenital ichthyosis. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524B15Rik C A 11: 31,915,770 (GRCm39) F37L probably benign Het
Akna T C 4: 63,292,636 (GRCm39) E1091G probably benign Het
Asxl3 A G 18: 22,650,101 (GRCm39) T697A probably benign Het
Cdk5r1 A G 11: 80,368,414 (GRCm39) Y27C probably damaging Het
Cdkl2 T A 5: 92,165,244 (GRCm39) I511L probably benign Het
Clp1 A C 2: 84,556,477 (GRCm39) M1R probably null Het
Csrnp1 A C 9: 119,801,819 (GRCm39) D413E probably damaging Het
Gbp2 T C 3: 142,341,055 (GRCm39) S479P probably benign Het
Il23r A G 6: 67,408,603 (GRCm39) S413P probably damaging Het
Klb G T 5: 65,537,373 (GRCm39) R901L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lta4h G A 10: 93,308,818 (GRCm39) V373I probably benign Het
Map3k1 G T 13: 111,904,630 (GRCm39) Q385K probably benign Het
Mapk8ip2 A T 15: 89,343,160 (GRCm39) D634V probably damaging Het
Myocd T C 11: 65,078,217 (GRCm39) E526G probably damaging Het
Nup188 T A 2: 30,227,045 (GRCm39) V1206E probably damaging Het
Pak6 A G 2: 118,520,396 (GRCm39) Y129C probably damaging Het
Pigp T A 16: 94,166,332 (GRCm39) K125N probably damaging Het
Pmm1 G A 15: 81,840,460 (GRCm39) T95M possibly damaging Het
Prrt3 A T 6: 113,474,032 (GRCm39) N335K probably damaging Het
Rsrc2 T C 5: 123,868,561 (GRCm39) N361S probably benign Het
Slc45a1 T C 4: 150,722,982 (GRCm39) T301A probably benign Het
Spata19 A C 9: 27,311,744 (GRCm39) D121A probably damaging Het
Speg T A 1: 75,395,617 (GRCm39) L1796* probably null Het
Stx2 A G 5: 129,063,422 (GRCm39) S288P unknown Het
Tlk1 C T 2: 70,600,400 (GRCm39) S93N probably damaging Het
Tmc8 A G 11: 117,676,029 (GRCm39) D256G probably damaging Het
Vldlr T C 19: 27,218,720 (GRCm39) Y524H possibly damaging Het
Vmn1r168 T C 7: 23,240,509 (GRCm39) F122S probably benign Het
Vmn2r67 T C 7: 84,802,037 (GRCm39) N88S probably benign Het
Zhx1 A G 15: 57,918,207 (GRCm39) V13A probably damaging Het
Other mutations in Nipal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Nipal4 APN 11 46,042,152 (GRCm39) missense probably damaging 1.00
IGL03203:Nipal4 APN 11 46,041,123 (GRCm39) missense probably damaging 1.00
H8786:Nipal4 UTSW 11 46,041,304 (GRCm39) missense probably damaging 1.00
R0239:Nipal4 UTSW 11 46,041,268 (GRCm39) missense possibly damaging 0.80
R0239:Nipal4 UTSW 11 46,041,268 (GRCm39) missense possibly damaging 0.80
R0331:Nipal4 UTSW 11 46,041,040 (GRCm39) missense probably damaging 1.00
R0414:Nipal4 UTSW 11 46,052,735 (GRCm39) missense probably damaging 1.00
R0613:Nipal4 UTSW 11 46,041,211 (GRCm39) missense probably benign 0.31
R0940:Nipal4 UTSW 11 46,041,139 (GRCm39) missense possibly damaging 0.48
R1797:Nipal4 UTSW 11 46,042,160 (GRCm39) missense probably benign 0.06
R1889:Nipal4 UTSW 11 46,041,560 (GRCm39) missense probably damaging 0.99
R1899:Nipal4 UTSW 11 46,041,058 (GRCm39) missense probably damaging 1.00
R1974:Nipal4 UTSW 11 46,042,210 (GRCm39) missense probably damaging 1.00
R2066:Nipal4 UTSW 11 46,047,622 (GRCm39) missense probably damaging 1.00
R3705:Nipal4 UTSW 11 46,052,678 (GRCm39) splice site probably benign
R3941:Nipal4 UTSW 11 46,041,473 (GRCm39) missense probably damaging 1.00
R4597:Nipal4 UTSW 11 46,042,156 (GRCm39) missense probably damaging 1.00
R4965:Nipal4 UTSW 11 46,052,837 (GRCm39) missense possibly damaging 0.68
R5888:Nipal4 UTSW 11 46,042,166 (GRCm39) missense probably damaging 0.98
R6533:Nipal4 UTSW 11 46,041,234 (GRCm39) nonsense probably null
R7444:Nipal4 UTSW 11 46,057,062 (GRCm39) missense probably benign 0.27
R8099:Nipal4 UTSW 11 46,052,848 (GRCm39) missense probably benign 0.05
R8203:Nipal4 UTSW 11 46,041,147 (GRCm39) missense probably damaging 1.00
R8825:Nipal4 UTSW 11 46,052,873 (GRCm39) missense probably benign 0.01
R8826:Nipal4 UTSW 11 46,045,470 (GRCm39) missense possibly damaging 0.63
R8881:Nipal4 UTSW 11 46,042,177 (GRCm39) missense probably benign 0.00
R9514:Nipal4 UTSW 11 46,052,922 (GRCm39) critical splice acceptor site probably null
X0018:Nipal4 UTSW 11 46,052,873 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTATACCACTCCTTGAAGAGGAC -3'
(R):5'- CCCTTGAGTCCTTTGCTGAATAAC -3'

Sequencing Primer
(F):5'- ATGGAGGAGGCCACCAC -3'
(R):5'- GAGTCCTTTGCTGAATAACTTTTACC -3'
Posted On 2022-11-14