Mutagenetix > Incidental Mutation

Incidental Mutation 'R9768:Cdk5r1'

733377

Institutional Source

Beutler Lab

Gene Symbol

Cdk5r1

Ensembl Gene

ENSMUSG00000048895

Gene Name

cyclin dependent kinase 5, regulatory subunit 1

Synonyms

p25, p35, D11Bwg0379e

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.710) question?

Stock #

R9768 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80367849-80372010 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80368414 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 27 (Y27C)

Ref Sequence

ENSEMBL: ENSMUSP00000120964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]

AlphaFold

P61809

Predicted Effect

probably benign
Transcript: ENSMUST00000017572

SMART Domains

Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
PAM	143	320	1.6e-67	SMART
PINT	321	404	4.34e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000041065

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053413
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: Y27C

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	69	294	1.6e-100	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000147694
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895
AA Change: Y27C

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	1	138	2.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173797

SMART Domains

Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

Domain	Start	End	E-Value	Type
Blast:PAM	2	58	9e-33	BLAST
PINT	59	142	4.34e-23	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524B15Rik	C	A	11: 31,915,770 (GRCm39)	F37L	probably benign	Het
Akna	T	C	4: 63,292,636 (GRCm39)	E1091G	probably benign	Het
Asxl3	A	G	18: 22,650,101 (GRCm39)	T697A	probably benign	Het
Cdkl2	T	A	5: 92,165,244 (GRCm39)	I511L	probably benign	Het
Clp1	A	C	2: 84,556,477 (GRCm39)	M1R	probably null	Het
Csrnp1	A	C	9: 119,801,819 (GRCm39)	D413E	probably damaging	Het
Gbp2	T	C	3: 142,341,055 (GRCm39)	S479P	probably benign	Het
Il23r	A	G	6: 67,408,603 (GRCm39)	S413P	probably damaging	Het
Klb	G	T	5: 65,537,373 (GRCm39)	R901L	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,758,813 (GRCm39)		probably benign	Het
Lta4h	G	A	10: 93,308,818 (GRCm39)	V373I	probably benign	Het
Map3k1	G	T	13: 111,904,630 (GRCm39)	Q385K	probably benign	Het
Mapk8ip2	A	T	15: 89,343,160 (GRCm39)	D634V	probably damaging	Het
Myocd	T	C	11: 65,078,217 (GRCm39)	E526G	probably damaging	Het
Nipal4	C	T	11: 46,041,473 (GRCm39)	V241M	probably damaging	Het
Nup188	T	A	2: 30,227,045 (GRCm39)	V1206E	probably damaging	Het
Pak6	A	G	2: 118,520,396 (GRCm39)	Y129C	probably damaging	Het
Pigp	T	A	16: 94,166,332 (GRCm39)	K125N	probably damaging	Het
Pmm1	G	A	15: 81,840,460 (GRCm39)	T95M	possibly damaging	Het
Prrt3	A	T	6: 113,474,032 (GRCm39)	N335K	probably damaging	Het
Rsrc2	T	C	5: 123,868,561 (GRCm39)	N361S	probably benign	Het
Slc45a1	T	C	4: 150,722,982 (GRCm39)	T301A	probably benign	Het
Spata19	A	C	9: 27,311,744 (GRCm39)	D121A	probably damaging	Het
Speg	T	A	1: 75,395,617 (GRCm39)	L1796*	probably null	Het
Stx2	A	G	5: 129,063,422 (GRCm39)	S288P	unknown	Het
Tlk1	C	T	2: 70,600,400 (GRCm39)	S93N	probably damaging	Het
Tmc8	A	G	11: 117,676,029 (GRCm39)	D256G	probably damaging	Het
Vldlr	T	C	19: 27,218,720 (GRCm39)	Y524H	possibly damaging	Het
Vmn1r168	T	C	7: 23,240,509 (GRCm39)	F122S	probably benign	Het
Vmn2r67	T	C	7: 84,802,037 (GRCm39)	N88S	probably benign	Het
Zhx1	A	G	15: 57,918,207 (GRCm39)	V13A	probably damaging	Het

Other mutations in Cdk5r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02450:Cdk5r1	APN	11	80,368,666 (GRCm39)	missense	probably benign	0.09
IGL02754:Cdk5r1	APN	11	80,368,569 (GRCm39)	missense	probably benign	0.00
R0230:Cdk5r1	UTSW	11	80,368,576 (GRCm39)	missense	probably damaging	1.00
R4166:Cdk5r1	UTSW	11	80,369,035 (GRCm39)	missense	probably damaging	1.00
R5537:Cdk5r1	UTSW	11	80,368,825 (GRCm39)	missense	probably damaging	1.00
R5926:Cdk5r1	UTSW	11	80,369,128 (GRCm39)	splice site	probably null
R6350:Cdk5r1	UTSW	11	80,369,068 (GRCm39)	missense	probably damaging	1.00
R6841:Cdk5r1	UTSW	11	80,369,021 (GRCm39)	nonsense	probably null
R7542:Cdk5r1	UTSW	11	80,369,190 (GRCm39)	missense	probably damaging	1.00
R9612:Cdk5r1	UTSW	11	80,368,480 (GRCm39)	missense	probably benign	0.00
T0722:Cdk5r1	UTSW	11	80,368,707 (GRCm39)	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- TTGTTTTCCACGCAGATCCG -3'
(R):5'- CATTGTTGAGATGCGCGATG -3'

Sequencing Primer
(F):5'- AGGACTAAACGCGTCGTGTC -3'
(R):5'- AGATGCGCGATGTTGCTC -3'

Posted On

2022-11-14