Incidental Mutation 'R9772:Clca4a'
ID 733475
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R9772 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 144970661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 86 (W86L)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: W86L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: W86L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A T 2: 27,095,654 I517F probably benign Het
Ankdd1a A G 9: 65,501,467 C506R probably damaging Het
Arid3c T C 4: 41,724,723 N371D probably damaging Het
Ccdc117 C T 11: 5,542,042 R6Q possibly damaging Het
Ccdc78 C T 17: 25,786,691 R26* probably null Het
Clrn2 C T 5: 45,454,027 Q73* probably null Het
Cpne6 A G 14: 55,516,660 D478G probably benign Het
Cyp2c40 T A 19: 39,803,904 I199L probably benign Het
Dna2 T C 10: 62,950,743 V90A probably benign Het
Dydc1 A G 14: 41,082,291 E90G probably damaging Het
Egf A T 3: 129,706,107 S795T probably benign Het
Fam129b T C 2: 32,905,856 I48T probably damaging Het
Gm13090 G T 4: 151,091,108 A102S unknown Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Ltf T C 9: 111,040,357 S87P unknown Het
Mesp2 A G 7: 79,811,600 I224M possibly damaging Het
Mettl25 T C 10: 105,797,266 R439G probably benign Het
Mettl27 C T 5: 134,933,536 R63W possibly damaging Het
Nap1l1 C T 10: 111,490,050 R77* probably null Het
Notch4 G T 17: 34,573,909 probably null Het
Npepps A G 11: 97,223,157 I631T probably benign Het
Olfr1202 G A 2: 88,817,614 V148I probably benign Het
Olfr916 A T 9: 38,657,668 C241* probably null Het
Pacsin3 T A 2: 91,262,793 L210Q probably damaging Het
Ppp2r1a A T 17: 20,961,593 I458F probably damaging Het
Ryr2 T C 13: 11,594,899 E4347G probably benign Het
Ryr3 A G 2: 112,826,703 I1911T probably damaging Het
Sec16a A G 2: 26,439,405 I866T possibly damaging Het
Sfr1 G T 19: 47,733,580 C145F probably benign Het
Slc35f4 A T 14: 49,313,718 Y230N probably damaging Het
Slx4 A G 16: 4,000,985 V89A Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d23 A G 16: 57,170,402 I671T probably damaging Het
Trub1 G A 19: 57,483,643 V184I probably benign Het
Usp10 CAA CAAA 8: 119,931,881 probably null Het
Vit A C 17: 78,624,969 T502P probably damaging Het
Vmn2r15 C T 5: 109,287,057 G594R probably damaging Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144953771 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGCCACTTTAATGTCAGC -3'
(R):5'- TAACAGCTTAACAGGGTTCACC -3'

Sequencing Primer
(F):5'- GCCACTTTAATGTCAGCCTGAGAATG -3'
(R):5'- GTTCACCAGAGAAGTGCACCTG -3'
Posted On 2022-11-14