Incidental Mutation 'R9773:Wdr35'
ID 733546
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9773 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 9023897-9078848 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9039990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 365 (N365S)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000160329]
AlphaFold Q8BND3
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: N365S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: N365S

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: N365S

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: N365S

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160329
SMART Domains Protein: ENSMUSP00000124285
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
low complexity region 172 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,057 (GRCm39) Y483H possibly damaging Het
Abca17 A G 17: 24,508,565 (GRCm39) L990P probably damaging Het
Ankrd65 A C 4: 155,877,424 (GRCm39) T312P probably damaging Het
Atp23 G A 10: 126,734,763 (GRCm39) T103M possibly damaging Het
Bmpr2 T A 1: 59,907,497 (GRCm39) S863R probably damaging Het
Cacna1c T A 6: 118,647,371 (GRCm39) N992I Het
Cacnb2 A G 2: 14,976,452 (GRCm39) E291G probably damaging Het
Calcrl T C 2: 84,200,462 (GRCm39) Q106R probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cngb1 G A 8: 95,975,042 (GRCm39) H1144Y probably damaging Het
Cnot4 A T 6: 35,056,920 (GRCm39) N50K probably damaging Het
Coasy T C 11: 100,975,163 (GRCm39) L240P probably damaging Het
D7Ertd443e G A 7: 133,959,803 (GRCm39) T12M probably benign Het
Exoc3l2 A G 7: 19,203,697 (GRCm39) I96M Het
Fbn2 A G 18: 58,143,481 (GRCm39) L2858P probably benign Het
Fbxw21 A G 9: 108,977,128 (GRCm39) S194P possibly damaging Het
Fry T C 5: 150,322,728 (GRCm39) L1040P probably damaging Het
Gimap8 C T 6: 48,633,568 (GRCm39) P300S unknown Het
Gm10801 T G 2: 98,494,345 (GRCm39) F141V probably benign Het
Gm21903 G A 17: 39,353,541 (GRCm39) T25I unknown Het
Gucy2d T C 7: 98,099,048 (GRCm39) V288A possibly damaging Het
Hs6st3 A T 14: 120,106,948 (GRCm39) D452V probably benign Het
Igkv5-43 T A 6: 69,752,858 (GRCm39) I75F probably damaging Het
Itgad G A 7: 127,789,222 (GRCm39) R562H probably damaging Het
Kbtbd12 T A 6: 88,524,744 (GRCm39) D613V probably damaging Het
Kcnn2 A G 18: 45,788,365 (GRCm39) T363A probably damaging Het
Kyat3 A G 3: 142,431,820 (GRCm39) I213M probably damaging Het
Lrig2 A T 3: 104,368,838 (GRCm39) H948Q probably benign Het
Marchf7 C T 2: 60,064,785 (GRCm39) R354* probably null Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Myh4 C T 11: 67,137,263 (GRCm39) H495Y probably damaging Het
Or13a23-ps1 T C 7: 140,118,649 (GRCm39) V73A probably benign Het
Or4d10b A T 19: 12,036,939 (GRCm39) M59K possibly damaging Het
Or6c69c T A 10: 129,910,360 (GRCm39) I27N possibly damaging Het
Plcb2 T C 2: 118,541,274 (GRCm39) E1021G probably damaging Het
Plekhg2 G A 7: 28,069,743 (GRCm39) P97S probably damaging Het
Pon1 T C 6: 5,177,339 (GRCm39) Y190C possibly damaging Het
Pth1r C A 9: 110,556,233 (GRCm39) R213S possibly damaging Het
Ptprg A G 14: 12,199,806 (GRCm38) D848G probably damaging Het
Rnpepl1 C A 1: 92,847,559 (GRCm39) D715E probably damaging Het
Serpinb3b C A 1: 107,085,416 (GRCm39) K108N possibly damaging Het
Slc1a1 C T 19: 28,870,283 (GRCm39) A94V probably damaging Het
Slc22a30 A T 19: 8,321,754 (GRCm39) Y437N probably benign Het
Slc2a7 C T 4: 150,234,044 (GRCm39) T53I possibly damaging Het
Spag1 A G 15: 36,234,711 (GRCm39) T824A probably benign Het
Spmip7 G A 11: 11,438,572 (GRCm39) V272M unknown Het
Synj2 T A 17: 6,094,232 (GRCm39) Y1153N probably benign Het
Ttll2 A T 17: 7,618,676 (GRCm39) I417K probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Uevld A G 7: 46,597,659 (GRCm39) probably null Het
Vmn2r38 A G 7: 9,097,806 (GRCm39) S96P probably damaging Het
Vmn2r92 A G 17: 18,386,949 (GRCm39) N96S probably damaging Het
Vmn2r97 T A 17: 19,168,221 (GRCm39) I825N probably benign Het
Vps13d T A 4: 144,818,619 (GRCm39) M3083L Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9,069,900 (GRCm39) missense probably benign
IGL00962:Wdr35 APN 12 9,071,726 (GRCm39) splice site probably benign
IGL01094:Wdr35 APN 12 9,055,838 (GRCm39) splice site probably benign
IGL01312:Wdr35 APN 12 9,058,655 (GRCm39) missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9,058,550 (GRCm39) missense probably benign 0.04
IGL01490:Wdr35 APN 12 9,027,381 (GRCm39) missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9,058,535 (GRCm39) missense probably null 0.04
IGL02319:Wdr35 APN 12 9,077,480 (GRCm39) unclassified probably benign
IGL02548:Wdr35 APN 12 9,074,297 (GRCm39) missense probably benign 0.00
IGL02941:Wdr35 APN 12 9,077,507 (GRCm39) missense probably damaging 0.98
IGL03038:Wdr35 APN 12 9,024,185 (GRCm39) splice site probably benign
IGL03086:Wdr35 APN 12 9,058,692 (GRCm39) splice site probably null
IGL03207:Wdr35 APN 12 9,039,936 (GRCm39) missense probably damaging 0.98
IGL03327:Wdr35 APN 12 9,028,694 (GRCm39) splice site probably benign
R0362:Wdr35 UTSW 12 9,045,625 (GRCm39) unclassified probably benign
R0464:Wdr35 UTSW 12 9,077,472 (GRCm39) unclassified probably benign
R0487:Wdr35 UTSW 12 9,062,743 (GRCm39) critical splice donor site probably null
R0976:Wdr35 UTSW 12 9,036,104 (GRCm39) missense probably benign 0.03
R1349:Wdr35 UTSW 12 9,069,870 (GRCm39) splice site probably benign
R1663:Wdr35 UTSW 12 9,070,000 (GRCm39) missense probably benign 0.00
R1769:Wdr35 UTSW 12 9,062,728 (GRCm39) missense probably damaging 1.00
R1779:Wdr35 UTSW 12 9,035,772 (GRCm39) missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 9,027,435 (GRCm39) critical splice donor site probably null
R1893:Wdr35 UTSW 12 9,035,994 (GRCm39) missense probably benign
R2076:Wdr35 UTSW 12 9,074,281 (GRCm39) missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 9,024,955 (GRCm39) missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 9,028,628 (GRCm39) missense probably benign 0.01
R2281:Wdr35 UTSW 12 9,028,628 (GRCm39) missense probably benign 0.01
R2863:Wdr35 UTSW 12 9,078,060 (GRCm39) nonsense probably null
R3713:Wdr35 UTSW 12 9,077,648 (GRCm39) missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 9,036,077 (GRCm39) missense probably benign
R3934:Wdr35 UTSW 12 9,058,014 (GRCm39) missense probably damaging 1.00
R4360:Wdr35 UTSW 12 9,024,149 (GRCm39) utr 5 prime probably benign
R4402:Wdr35 UTSW 12 9,039,981 (GRCm39) missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9,065,995 (GRCm39) missense probably benign 0.00
R4656:Wdr35 UTSW 12 9,066,619 (GRCm39) missense probably benign 0.00
R4780:Wdr35 UTSW 12 9,068,150 (GRCm39) missense probably benign
R5092:Wdr35 UTSW 12 9,037,327 (GRCm39) missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9,058,487 (GRCm39) missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9,068,142 (GRCm39) missense probably damaging 1.00
R5346:Wdr35 UTSW 12 9,028,684 (GRCm39) missense probably benign 0.00
R5435:Wdr35 UTSW 12 9,039,951 (GRCm39) missense probably benign 0.01
R5472:Wdr35 UTSW 12 9,066,619 (GRCm39) missense probably benign 0.00
R5682:Wdr35 UTSW 12 9,031,125 (GRCm39) missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9,056,723 (GRCm39) missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9,066,511 (GRCm39) missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9,077,632 (GRCm39) missense probably benign 0.05
R6531:Wdr35 UTSW 12 9,028,685 (GRCm39) missense probably benign 0.00
R6746:Wdr35 UTSW 12 9,053,982 (GRCm39) splice site probably null
R6816:Wdr35 UTSW 12 9,077,724 (GRCm39) critical splice donor site probably null
R6863:Wdr35 UTSW 12 9,040,047 (GRCm39) missense probably damaging 0.97
R7088:Wdr35 UTSW 12 9,028,659 (GRCm39) missense probably benign 0.11
R7140:Wdr35 UTSW 12 9,072,785 (GRCm39) missense probably damaging 0.98
R7327:Wdr35 UTSW 12 9,037,312 (GRCm39) missense probably benign 0.10
R7403:Wdr35 UTSW 12 9,062,685 (GRCm39) missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9,054,105 (GRCm39) missense probably benign 0.00
R7438:Wdr35 UTSW 12 9,072,785 (GRCm39) missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9,055,773 (GRCm39) missense probably benign
R7491:Wdr35 UTSW 12 9,036,000 (GRCm39) missense probably benign 0.00
R7599:Wdr35 UTSW 12 9,074,886 (GRCm39) missense probably benign 0.01
R7620:Wdr35 UTSW 12 9,066,042 (GRCm39) missense probably benign 0.04
R7857:Wdr35 UTSW 12 9,058,113 (GRCm39) critical splice donor site probably null
R8289:Wdr35 UTSW 12 9,058,020 (GRCm39) missense probably benign 0.00
R8302:Wdr35 UTSW 12 9,078,110 (GRCm39) missense probably benign 0.09
R8433:Wdr35 UTSW 12 9,058,495 (GRCm39) missense probably damaging 1.00
R8479:Wdr35 UTSW 12 9,035,985 (GRCm39) missense probably benign 0.04
R8498:Wdr35 UTSW 12 9,058,626 (GRCm39) missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9,075,044 (GRCm39) critical splice donor site probably null
R9220:Wdr35 UTSW 12 9,036,000 (GRCm39) missense possibly damaging 0.49
R9368:Wdr35 UTSW 12 9,071,826 (GRCm39) missense probably benign 0.00
R9573:Wdr35 UTSW 12 9,078,014 (GRCm39) missense probably benign 0.00
R9596:Wdr35 UTSW 12 9,036,092 (GRCm39) missense probably benign 0.08
X0066:Wdr35 UTSW 12 9,040,029 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCTGATAACCGCAACTGTTAC -3'
(R):5'- GGAGAGCCAATGTTCTGTCC -3'

Sequencing Primer
(F):5'- ACCGCAACTGTTACACTATTTTG -3'
(R):5'- AGTGCCCGTGCTTGAGGAG -3'
Posted On 2022-11-14