Mutagenetix > Incidental Mutation

Incidental Mutation 'R9773:Abca17'

733555

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9773 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24289591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 990 (L990P)

Ref Sequence

ENSEMBL: ENSMUSP00000046218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

probably damaging
Transcript: ENSMUST00000039324
AA Change: L990P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: L990P

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121226
AA Change: L990P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: L990P

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,850,193	Y483H	possibly damaging	Het
Ankrd65	A	C	4: 155,792,967	T312P	probably damaging	Het
Atp23	G	A	10: 126,898,894	T103M	possibly damaging	Het
Bmpr2	T	A	1: 59,868,338	S863R	probably damaging	Het
Cacna1c	T	A	6: 118,670,410	N992I		Het
Cacnb2	A	G	2: 14,971,641	E291G	probably damaging	Het
Calcrl	T	C	2: 84,370,118	Q106R	probably benign	Het
Clip2	C	T	5: 134,504,762	R487Q	probably benign	Het
Cngb1	G	A	8: 95,248,414	H1144Y	probably damaging	Het
Cnot4	A	T	6: 35,079,985	N50K	probably damaging	Het
Coasy	T	C	11: 101,084,337	L240P	probably damaging	Het
D7Ertd443e	G	A	7: 134,358,074	T12M	probably benign	Het
Exoc3l2	A	G	7: 19,469,772	I96M		Het
Fbn2	A	G	18: 58,010,409	L2858P	probably benign	Het
Fbxw21	A	G	9: 109,148,060	S194P	possibly damaging	Het
Fry	T	C	5: 150,399,263	L1040P	probably damaging	Het
Gimap8	C	T	6: 48,656,634	P300S	unknown	Het
Gm10801	T	G	2: 98,664,000	F141V	probably benign	Het
Gm21903	G	A	17: 39,042,650	T25I	unknown	Het
Gucy2d	T	C	7: 98,449,841	V288A	possibly damaging	Het
Hs6st3	A	T	14: 119,869,536	D452V	probably benign	Het
Igkv5-45	T	A	6: 69,775,874	I75F	probably damaging	Het
Itgad	G	A	7: 128,190,050	R562H	probably damaging	Het
Kbtbd12	T	A	6: 88,547,762	D613V	probably damaging	Het
Kcnn2	A	G	18: 45,655,298	T363A	probably damaging	Het
Kyat3	A	G	3: 142,726,059	I213M	probably damaging	Het
Lrig2	A	T	3: 104,461,522	H948Q	probably benign	Het
March7	C	T	2: 60,234,441	R354*	probably null	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Myh4	C	T	11: 67,246,437	H495Y	probably damaging	Het
Olfr1424	A	T	19: 12,059,575	M59K	possibly damaging	Het
Olfr537-ps1	T	C	7: 140,538,736	V73A	probably benign	Het
Olfr822	T	A	10: 130,074,491	I27N	possibly damaging	Het
Plcb2	T	C	2: 118,710,793	E1021G	probably damaging	Het
Plekhg2	G	A	7: 28,370,318	P97S	probably damaging	Het
Pon1	T	C	6: 5,177,339	Y190C	possibly damaging	Het
Pth1r	C	A	9: 110,727,165	R213S	possibly damaging	Het
Ptprg	A	G	14: 12,199,806	D848G	probably damaging	Het
Rnpepl1	C	A	1: 92,919,837	D715E	probably damaging	Het
Serpinb3b	C	A	1: 107,157,686	K108N	possibly damaging	Het
Slc1a1	C	T	19: 28,892,883	A94V	probably damaging	Het
Slc22a30	A	T	19: 8,344,390	Y437N	probably benign	Het
Slc2a7	C	T	4: 150,149,587	T53I	possibly damaging	Het
Spag1	A	G	15: 36,234,565	T824A	probably benign	Het
Spata48	G	A	11: 11,488,572	V272M	unknown	Het
Synj2	T	A	17: 6,043,957	Y1153N	probably benign	Het
Ttll2	A	T	17: 7,351,277	I417K	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Uevld	A	G	7: 46,947,911		probably null	Het
Vmn2r38	A	G	7: 9,094,807	S96P	probably damaging	Het
Vmn2r92	A	G	17: 18,166,687	N96S	probably damaging	Het
Vmn2r97	T	A	17: 18,947,959	I825N	probably benign	Het
Vps13d	T	A	4: 145,092,049	M3083L		Het
Wdr35	A	G	12: 8,989,990	N365S	probably benign	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
R9440:Abca17	UTSW	17	24280478	missense	probably benign	0.02
R9498:Abca17	UTSW	17	24265506	missense	probably damaging	1.00
R9654:Abca17	UTSW	17	24317125	missense	probably benign	0.09
R9709:Abca17	UTSW	17	24298960	missense	probably benign
R9770:Abca17	UTSW	17	24295147	missense	probably benign	0.00
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCATTGGCTCCAGAAAGCAAC -3'
(R):5'- TGGAGAGATCGGCTGGAATTC -3'

Sequencing Primer
(F):5'- ACTTGAAGAGAAGATTGTCCACC -3'
(R):5'- TCGGCTGGAATTCAATAGAGAGCTG -3'

Posted On

2022-11-14