Incidental Mutation 'R9774:Vmn2r14'
ID 733578
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R9774 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109369126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 149 (T149I)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: T149I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: T149I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik A C 7: 30,399,261 (GRCm39) Q18H possibly damaging Het
Adam23 C T 1: 63,585,583 (GRCm39) T390I probably benign Het
Adh7 T A 3: 137,929,847 (GRCm39) C174* probably null Het
Brip1 A G 11: 86,077,838 (GRCm39) S197P possibly damaging Het
Ccdc146 G T 5: 21,506,247 (GRCm39) D731E probably benign Het
Cfi T C 3: 129,668,645 (GRCm39) V557A probably damaging Het
Col4a4 A T 1: 82,484,665 (GRCm39) probably null Het
Csnka2ip T C 16: 64,299,093 (GRCm39) I424V unknown Het
Cubn C T 2: 13,433,530 (GRCm39) V1127I probably benign Het
Ehhadh T C 16: 21,581,976 (GRCm39) T339A probably benign Het
Ezh2 T A 6: 47,519,315 (GRCm39) I506L probably benign Het
Fbxw21 T C 9: 108,991,057 (GRCm39) M1V probably null Het
Herc1 T A 9: 66,372,032 (GRCm39) V567E probably null Het
Hrh1 A T 6: 114,457,241 (GRCm39) E174V probably benign Het
Il12rb1 A G 8: 71,272,040 (GRCm39) S585G possibly damaging Het
Kcnq4 C A 4: 120,573,076 (GRCm39) A242S probably damaging Het
Ltbp3 A G 19: 5,804,014 (GRCm39) N842S probably benign Het
Mbd1 A G 18: 74,408,274 (GRCm39) Q309R probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mroh2b T C 15: 4,943,613 (GRCm39) I383T probably benign Het
Mrto4 T C 4: 139,075,287 (GRCm39) D172G probably benign Het
Muc2 T G 7: 141,285,811 (GRCm39) S19A probably benign Het
Ndufb2 T C 6: 39,575,301 (GRCm39) probably null Het
Npas3 A T 12: 53,994,108 (GRCm39) T246S probably damaging Het
Or8u8 C T 2: 86,012,015 (GRCm39) V147M possibly damaging Het
Pappa2 T A 1: 158,675,920 (GRCm39) N942I probably damaging Het
Pdzph1 A G 17: 59,281,751 (GRCm39) V177A probably benign Het
Rab5b A G 10: 128,522,658 (GRCm39) V41A probably benign Het
Rnf111 T C 9: 70,334,303 (GRCm39) D980G probably damaging Het
Rreb1 A G 13: 38,114,185 (GRCm39) T515A probably benign Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,229,138 (GRCm39) probably benign Het
Serpinb13 T A 1: 106,923,579 (GRCm39) F95I probably benign Het
Sgsm3 C T 15: 80,890,673 (GRCm39) R76C possibly damaging Het
Slc1a1 C T 19: 28,870,283 (GRCm39) A94V probably damaging Het
Slc22a6 T C 19: 8,603,134 (GRCm39) V494A probably benign Het
Spag9 A G 11: 94,005,062 (GRCm39) E1182G probably damaging Het
Spata13 T C 14: 60,944,196 (GRCm39) S530P probably benign Het
Spatc1l A G 10: 76,405,168 (GRCm39) probably null Het
Spg11 A G 2: 121,938,965 (GRCm39) S330P probably damaging Het
Stau2 A T 1: 16,445,010 (GRCm39) M306K probably damaging Het
Tcea2 C T 2: 181,328,664 (GRCm39) T239I probably damaging Het
Tlcd2 A G 11: 75,359,131 (GRCm39) D34G probably damaging Het
Tmem132a C T 19: 10,842,904 (GRCm39) W190* probably null Het
Top3a C A 11: 60,638,998 (GRCm39) V551L probably damaging Het
Trpm1 G A 7: 63,898,041 (GRCm39) E1225K possibly damaging Het
Tti2 A G 8: 31,645,660 (GRCm39) H350R probably damaging Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tyw3 T C 3: 154,302,584 (GRCm39) D27G probably damaging Het
Usp36 G A 11: 118,153,875 (GRCm39) A1012V probably damaging Het
Vps13c T A 9: 67,791,873 (GRCm39) S380T possibly damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109,369,222 (GRCm39) missense probably benign
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109,364,041 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTTGTAGGCACATGTAAATGGAC -3'
(R):5'- ACTGTAATCTAGTTCAAGGTTGGC -3'

Sequencing Primer
(F):5'- GAGTTCAATTCCCAGTAACCATGTGG -3'
(R):5'- CCAGCAAGAAGACATGAGTTTTTCC -3'
Posted On 2022-11-14