Incidental Mutation 'R9774:Usp36'
ID 733599
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R9774 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118153875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1012 (A1012V)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: A1012V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: A1012V

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: A1012V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: A1012V

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144153
AA Change: A847V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: A847V

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik A C 7: 30,399,261 (GRCm39) Q18H possibly damaging Het
Adam23 C T 1: 63,585,583 (GRCm39) T390I probably benign Het
Adh7 T A 3: 137,929,847 (GRCm39) C174* probably null Het
Brip1 A G 11: 86,077,838 (GRCm39) S197P possibly damaging Het
Ccdc146 G T 5: 21,506,247 (GRCm39) D731E probably benign Het
Cfi T C 3: 129,668,645 (GRCm39) V557A probably damaging Het
Col4a4 A T 1: 82,484,665 (GRCm39) probably null Het
Csnka2ip T C 16: 64,299,093 (GRCm39) I424V unknown Het
Cubn C T 2: 13,433,530 (GRCm39) V1127I probably benign Het
Ehhadh T C 16: 21,581,976 (GRCm39) T339A probably benign Het
Ezh2 T A 6: 47,519,315 (GRCm39) I506L probably benign Het
Fbxw21 T C 9: 108,991,057 (GRCm39) M1V probably null Het
Herc1 T A 9: 66,372,032 (GRCm39) V567E probably null Het
Hrh1 A T 6: 114,457,241 (GRCm39) E174V probably benign Het
Il12rb1 A G 8: 71,272,040 (GRCm39) S585G possibly damaging Het
Kcnq4 C A 4: 120,573,076 (GRCm39) A242S probably damaging Het
Ltbp3 A G 19: 5,804,014 (GRCm39) N842S probably benign Het
Mbd1 A G 18: 74,408,274 (GRCm39) Q309R probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mroh2b T C 15: 4,943,613 (GRCm39) I383T probably benign Het
Mrto4 T C 4: 139,075,287 (GRCm39) D172G probably benign Het
Muc2 T G 7: 141,285,811 (GRCm39) S19A probably benign Het
Ndufb2 T C 6: 39,575,301 (GRCm39) probably null Het
Npas3 A T 12: 53,994,108 (GRCm39) T246S probably damaging Het
Or8u8 C T 2: 86,012,015 (GRCm39) V147M possibly damaging Het
Pappa2 T A 1: 158,675,920 (GRCm39) N942I probably damaging Het
Pdzph1 A G 17: 59,281,751 (GRCm39) V177A probably benign Het
Rab5b A G 10: 128,522,658 (GRCm39) V41A probably benign Het
Rnf111 T C 9: 70,334,303 (GRCm39) D980G probably damaging Het
Rreb1 A G 13: 38,114,185 (GRCm39) T515A probably benign Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,229,138 (GRCm39) probably benign Het
Serpinb13 T A 1: 106,923,579 (GRCm39) F95I probably benign Het
Sgsm3 C T 15: 80,890,673 (GRCm39) R76C possibly damaging Het
Slc1a1 C T 19: 28,870,283 (GRCm39) A94V probably damaging Het
Slc22a6 T C 19: 8,603,134 (GRCm39) V494A probably benign Het
Spag9 A G 11: 94,005,062 (GRCm39) E1182G probably damaging Het
Spata13 T C 14: 60,944,196 (GRCm39) S530P probably benign Het
Spatc1l A G 10: 76,405,168 (GRCm39) probably null Het
Spg11 A G 2: 121,938,965 (GRCm39) S330P probably damaging Het
Stau2 A T 1: 16,445,010 (GRCm39) M306K probably damaging Het
Tcea2 C T 2: 181,328,664 (GRCm39) T239I probably damaging Het
Tlcd2 A G 11: 75,359,131 (GRCm39) D34G probably damaging Het
Tmem132a C T 19: 10,842,904 (GRCm39) W190* probably null Het
Top3a C A 11: 60,638,998 (GRCm39) V551L probably damaging Het
Trpm1 G A 7: 63,898,041 (GRCm39) E1225K possibly damaging Het
Tti2 A G 8: 31,645,660 (GRCm39) H350R probably damaging Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tyw3 T C 3: 154,302,584 (GRCm39) D27G probably damaging Het
Vmn2r14 G A 5: 109,369,126 (GRCm39) T149I probably benign Het
Vps13c T A 9: 67,791,873 (GRCm39) S380T possibly damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAACTCCGCTGGCTTGTG -3'
(R):5'- TTATCACCAGAGAGTGAGTGTCTG -3'

Sequencing Primer
(F):5'- CTGGCTTGTGGTCCCCATG -3'
(R):5'- TGAGTGTCTGCTGGCACCAG -3'
Posted On 2022-11-14