Incidental Mutation 'R9774:Pdzph1'
ID 733607
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9774 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59281751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 177 (V177A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: V177A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: V177A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik A C 7: 30,399,261 (GRCm39) Q18H possibly damaging Het
Adam23 C T 1: 63,585,583 (GRCm39) T390I probably benign Het
Adh7 T A 3: 137,929,847 (GRCm39) C174* probably null Het
Brip1 A G 11: 86,077,838 (GRCm39) S197P possibly damaging Het
Ccdc146 G T 5: 21,506,247 (GRCm39) D731E probably benign Het
Cfi T C 3: 129,668,645 (GRCm39) V557A probably damaging Het
Col4a4 A T 1: 82,484,665 (GRCm39) probably null Het
Csnka2ip T C 16: 64,299,093 (GRCm39) I424V unknown Het
Cubn C T 2: 13,433,530 (GRCm39) V1127I probably benign Het
Ehhadh T C 16: 21,581,976 (GRCm39) T339A probably benign Het
Ezh2 T A 6: 47,519,315 (GRCm39) I506L probably benign Het
Fbxw21 T C 9: 108,991,057 (GRCm39) M1V probably null Het
Herc1 T A 9: 66,372,032 (GRCm39) V567E probably null Het
Hrh1 A T 6: 114,457,241 (GRCm39) E174V probably benign Het
Il12rb1 A G 8: 71,272,040 (GRCm39) S585G possibly damaging Het
Kcnq4 C A 4: 120,573,076 (GRCm39) A242S probably damaging Het
Ltbp3 A G 19: 5,804,014 (GRCm39) N842S probably benign Het
Mbd1 A G 18: 74,408,274 (GRCm39) Q309R probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mroh2b T C 15: 4,943,613 (GRCm39) I383T probably benign Het
Mrto4 T C 4: 139,075,287 (GRCm39) D172G probably benign Het
Muc2 T G 7: 141,285,811 (GRCm39) S19A probably benign Het
Ndufb2 T C 6: 39,575,301 (GRCm39) probably null Het
Npas3 A T 12: 53,994,108 (GRCm39) T246S probably damaging Het
Or8u8 C T 2: 86,012,015 (GRCm39) V147M possibly damaging Het
Pappa2 T A 1: 158,675,920 (GRCm39) N942I probably damaging Het
Rab5b A G 10: 128,522,658 (GRCm39) V41A probably benign Het
Rnf111 T C 9: 70,334,303 (GRCm39) D980G probably damaging Het
Rreb1 A G 13: 38,114,185 (GRCm39) T515A probably benign Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,229,138 (GRCm39) probably benign Het
Serpinb13 T A 1: 106,923,579 (GRCm39) F95I probably benign Het
Sgsm3 C T 15: 80,890,673 (GRCm39) R76C possibly damaging Het
Slc1a1 C T 19: 28,870,283 (GRCm39) A94V probably damaging Het
Slc22a6 T C 19: 8,603,134 (GRCm39) V494A probably benign Het
Spag9 A G 11: 94,005,062 (GRCm39) E1182G probably damaging Het
Spata13 T C 14: 60,944,196 (GRCm39) S530P probably benign Het
Spatc1l A G 10: 76,405,168 (GRCm39) probably null Het
Spg11 A G 2: 121,938,965 (GRCm39) S330P probably damaging Het
Stau2 A T 1: 16,445,010 (GRCm39) M306K probably damaging Het
Tcea2 C T 2: 181,328,664 (GRCm39) T239I probably damaging Het
Tlcd2 A G 11: 75,359,131 (GRCm39) D34G probably damaging Het
Tmem132a C T 19: 10,842,904 (GRCm39) W190* probably null Het
Top3a C A 11: 60,638,998 (GRCm39) V551L probably damaging Het
Trpm1 G A 7: 63,898,041 (GRCm39) E1225K possibly damaging Het
Tti2 A G 8: 31,645,660 (GRCm39) H350R probably damaging Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tyw3 T C 3: 154,302,584 (GRCm39) D27G probably damaging Het
Usp36 G A 11: 118,153,875 (GRCm39) A1012V probably damaging Het
Vmn2r14 G A 5: 109,369,126 (GRCm39) T149I probably benign Het
Vps13c T A 9: 67,791,873 (GRCm39) S380T possibly damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCAAGGGGCCTCTTCTATG -3'
(R):5'- ACAGAGGATTTCCCAAACACTG -3'

Sequencing Primer
(F):5'- CAAGGGGCCTCTTCTATGTTTTGTC -3'
(R):5'- TGTAGAAGTCTTAAAGCCAGCC -3'
Posted On 2022-11-14