Mutagenetix > Incidental Mutation

Incidental Mutation 'R9775:Cntnap2'

733634

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9775 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47049327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 970 (Y970C)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: Y970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: Y970C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000150737
AA Change: Y29C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: Y29C

Domain	Start	End	E-Value	Type
EGF	25	61	1e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	T	G	5: 113,723,704	Q35P	unknown	Het
Angptl2	G	A	2: 33,228,218	M1I	probably null	Het
B020004J07Rik	A	G	4: 101,837,047	M213T	probably benign	Het
Bptf	T	C	11: 107,043,676	E223G	probably benign	Het
C2cd3	T	A	7: 100,427,251	I805N		Het
Cep152	G	A	2: 125,581,740	Q914*	probably null	Het
Clasp2	A	G	9: 113,896,672	T794A	probably benign	Het
Ddx11	G	T	17: 66,138,162	V360L	probably damaging	Het
Fer1l6	G	A	15: 58,625,249	V1223I	probably benign	Het
Fez2	A	T	17: 78,400,754	I255N	probably damaging	Het
Gata3	A	G	2: 9,858,386	V439A	possibly damaging	Het
Il23a	G	C	10: 128,296,960	R143G	probably benign	Het
Kcnj9	T	A	1: 172,326,174	I128F	probably damaging	Het
Klhdc2	A	G	12: 69,303,619	D146G	probably damaging	Het
Klra6	T	A	6: 130,022,676	R110W	probably damaging	Het
Ldha	A	T	7: 46,841,623		probably benign	Het
Lingo2	C	A	4: 35,708,781	A400S	probably benign	Het
Lrrd1	A	T	5: 3,849,897	R67S	probably benign	Het
Mapk6	C	T	9: 75,388,386	C610Y	possibly damaging	Het
Mia3	G	A	1: 183,328,270	R656*	probably null	Het
Myoz2	T	C	3: 123,013,750	E137G	probably damaging	Het
Nemp2	T	A	1: 52,640,905	I96N	probably damaging	Het
Npy1r	A	G	8: 66,705,090	M351V	possibly damaging	Het
Nsg2	G	A	11: 32,055,029	S77N	possibly damaging	Het
Olfr1115	A	G	2: 87,252,224	M96V	probably damaging	Het
Olfr199	T	A	16: 59,215,706	R302S	possibly damaging	Het
Olfr787	T	C	10: 129,462,808	I44T	probably benign	Het
Osbpl9	G	A	4: 109,156,550		probably benign	Het
Pcolce2	G	A	9: 95,638,744	C58Y	probably damaging	Het
Piezo1	A	G	8: 122,482,188	F2480L	probably damaging	Het
Pip5k1c	T	A	10: 81,312,019	D419E	probably damaging	Het
Plppr1	A	T	4: 49,323,435	T242S	probably benign	Het
Ppp1r13b	A	C	12: 111,837,023	S254A	possibly damaging	Het
Ripk3	A	G	14: 55,785,795	L151S	unknown	Het
Scmh1	A	T	4: 120,483,623	M169L	probably benign	Het
Serpinb9d	A	T	13: 33,198,024	R159W	probably damaging	Het
Slc26a9	A	G	1: 131,763,232	R583G	possibly damaging	Het
Smim8	T	C	4: 34,769,068	E72G	probably damaging	Het
Sned1	A	G	1: 93,271,882	N511S	probably damaging	Het
Srprb	A	C	9: 103,201,291	V80G	probably benign	Het
Ssx2ip	G	A	3: 146,431,053	S352N	probably benign	Het
Tbccd1	A	G	16: 22,833,916	S152P	probably damaging	Het
Tenm4	T	C	7: 96,906,554	I2822T	possibly damaging	Het
Tff1	A	G	17: 31,164,998	V8A	probably benign	Het
Tmem132b	T	A	5: 125,787,502	S891T	probably benign	Het
Tmem200c	T	A	17: 68,842,123	V567D	probably damaging	Het
Trim3	G	A	7: 105,611,170	T708M	probably damaging	Het
Ttn	T	C	2: 76,714,583	N32725S	possibly damaging	Het
Ubash3b	T	G	9: 41,014,918	E633A	possibly damaging	Het
Usp4	A	G	9: 108,362,581	R170G	probably damaging	Het
Wdr33	T	A	18: 31,904,353	L1222Q	unknown	Het
Zfhx2	A	G	14: 55,067,105	S1141P	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGGCAGTTGTAGAAGCCCTTTG -3'
(R):5'- GTTCACTCTACCCTTAGAAGCAAAC -3'

Sequencing Primer
(F):5'- GCAGTTGTAGAAGCCCTTTGAACTC -3'
(R):5'- CCATTTGCATCTGAAGAAGCACTAG -3'

Posted On

2022-11-14