Incidental Mutation 'R9775:Fer1l6'
ID 733658
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9775 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58625249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1223 (V1223I)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: V1223I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: V1223I

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T G 5: 113,723,704 Q35P unknown Het
Angptl2 G A 2: 33,228,218 M1I probably null Het
B020004J07Rik A G 4: 101,837,047 M213T probably benign Het
Bptf T C 11: 107,043,676 E223G probably benign Het
C2cd3 T A 7: 100,427,251 I805N Het
Cep152 G A 2: 125,581,740 Q914* probably null Het
Clasp2 A G 9: 113,896,672 T794A probably benign Het
Cntnap2 A G 6: 47,049,327 Y970C probably damaging Het
Ddx11 G T 17: 66,138,162 V360L probably damaging Het
Fez2 A T 17: 78,400,754 I255N probably damaging Het
Gata3 A G 2: 9,858,386 V439A possibly damaging Het
Il23a G C 10: 128,296,960 R143G probably benign Het
Kcnj9 T A 1: 172,326,174 I128F probably damaging Het
Klhdc2 A G 12: 69,303,619 D146G probably damaging Het
Klra6 T A 6: 130,022,676 R110W probably damaging Het
Ldha A T 7: 46,841,623 probably benign Het
Lingo2 C A 4: 35,708,781 A400S probably benign Het
Lrrd1 A T 5: 3,849,897 R67S probably benign Het
Mapk6 C T 9: 75,388,386 C610Y possibly damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Myoz2 T C 3: 123,013,750 E137G probably damaging Het
Nemp2 T A 1: 52,640,905 I96N probably damaging Het
Npy1r A G 8: 66,705,090 M351V possibly damaging Het
Nsg2 G A 11: 32,055,029 S77N possibly damaging Het
Olfr1115 A G 2: 87,252,224 M96V probably damaging Het
Olfr199 T A 16: 59,215,706 R302S possibly damaging Het
Olfr787 T C 10: 129,462,808 I44T probably benign Het
Osbpl9 G A 4: 109,156,550 probably benign Het
Pcolce2 G A 9: 95,638,744 C58Y probably damaging Het
Piezo1 A G 8: 122,482,188 F2480L probably damaging Het
Pip5k1c T A 10: 81,312,019 D419E probably damaging Het
Plppr1 A T 4: 49,323,435 T242S probably benign Het
Ppp1r13b A C 12: 111,837,023 S254A possibly damaging Het
Ripk3 A G 14: 55,785,795 L151S unknown Het
Scmh1 A T 4: 120,483,623 M169L probably benign Het
Serpinb9d A T 13: 33,198,024 R159W probably damaging Het
Slc26a9 A G 1: 131,763,232 R583G possibly damaging Het
Smim8 T C 4: 34,769,068 E72G probably damaging Het
Sned1 A G 1: 93,271,882 N511S probably damaging Het
Srprb A C 9: 103,201,291 V80G probably benign Het
Ssx2ip G A 3: 146,431,053 S352N probably benign Het
Tbccd1 A G 16: 22,833,916 S152P probably damaging Het
Tenm4 T C 7: 96,906,554 I2822T possibly damaging Het
Tff1 A G 17: 31,164,998 V8A probably benign Het
Tmem132b T A 5: 125,787,502 S891T probably benign Het
Tmem200c T A 17: 68,842,123 V567D probably damaging Het
Trim3 G A 7: 105,611,170 T708M probably damaging Het
Ttn T C 2: 76,714,583 N32725S possibly damaging Het
Ubash3b T G 9: 41,014,918 E633A possibly damaging Het
Usp4 A G 9: 108,362,581 R170G probably damaging Het
Wdr33 T A 18: 31,904,353 L1222Q unknown Het
Zfhx2 A G 14: 55,067,105 S1141P probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGCAAGCCTCATTCAAC -3'
(R):5'- AATGCAAAATTCTGCTGAAGCC -3'

Sequencing Primer
(F):5'- AAACAGGCTGCCTTTCACGG -3'
(R):5'- AATTCTGCTGAAGCCCTGAG -3'
Posted On 2022-11-14