Incidental Mutation 'R9776:Bptf'
ID 733725
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms Falz, 9430093H17Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9776 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 106923907-107022953 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106969396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1013 (T1013A)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057892
AA Change: T888A

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T888A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106762
AA Change: T950A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T950A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: T1013A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T1013A

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T G 5: 113,861,765 (GRCm39) Q35P unknown Het
2010109A12Rik T A 5: 93,361,305 (GRCm39) *120K probably null Het
2700049A03Rik A G 12: 71,235,448 (GRCm39) T1133A possibly damaging Het
A830005F24Rik G A 13: 48,667,758 (GRCm39) R20Q unknown Het
Acta2 T C 19: 34,223,481 (GRCm39) T205A probably benign Het
Adcy5 A G 16: 35,100,725 (GRCm39) D759G probably damaging Het
Ankk1 T A 9: 49,330,714 (GRCm39) M276L probably benign Het
Arfgef2 G A 2: 166,713,447 (GRCm39) E1283K probably damaging Het
Arhgef26 G T 3: 62,246,803 (GRCm39) probably benign Het
Arhgef28 A C 13: 98,133,415 (GRCm39) S351A probably benign Het
Arih2 C T 9: 108,484,504 (GRCm39) G436S probably damaging Het
Camsap1 A T 2: 25,828,166 (GRCm39) V1186E probably benign Het
Capn10 G T 1: 92,871,586 (GRCm39) A395S possibly damaging Het
Ccdc184 A T 15: 98,066,737 (GRCm39) T181S probably damaging Het
Clasp1 T C 1: 118,509,108 (GRCm39) I1345T possibly damaging Het
Cpsf1 A T 15: 76,486,779 (GRCm39) H252Q probably damaging Het
Ctnna2 T A 6: 77,582,172 (GRCm39) M363L probably benign Het
Cyp24a1 G A 2: 170,338,625 (GRCm39) P24S probably benign Het
D130040H23Rik A G 8: 69,755,566 (GRCm39) H341R probably damaging Het
Dclk3 A G 9: 111,298,226 (GRCm39) E590G probably damaging Het
Ear2 A T 14: 44,340,729 (GRCm39) Y129F probably benign Het
Egf A G 3: 129,530,514 (GRCm39) L216P probably damaging Het
Fbxw9 T A 8: 85,792,523 (GRCm39) H319Q probably damaging Het
Gipr A G 7: 18,891,487 (GRCm39) S397P probably damaging Het
Gxylt2 G T 6: 100,682,072 (GRCm39) E90* probably null Het
Hnf1b T C 11: 83,784,283 (GRCm39) V473A probably benign Het
Iffo1 G A 6: 125,130,436 (GRCm39) E475K probably damaging Het
Ifi206 T A 1: 173,308,075 (GRCm39) R640S Het
Ipmk A G 10: 71,217,439 (GRCm39) S328G probably damaging Het
Kcnq1 A T 7: 142,737,368 (GRCm39) I229F probably damaging Het
Kif9 C A 9: 110,350,398 (GRCm39) T763N probably benign Het
Klhl36 C T 8: 120,601,129 (GRCm39) Q383* probably null Het
Lrp4 G T 2: 91,316,179 (GRCm39) V766F probably damaging Het
Mettl26 T A 17: 26,094,511 (GRCm39) M3K probably benign Het
Muc16 T A 9: 18,570,675 (GRCm39) I615F unknown Het
Myo7b T A 18: 32,133,068 (GRCm39) Q427L probably benign Het
Naip1 A G 13: 100,559,584 (GRCm39) M1140T probably benign Het
Ncapg G A 5: 45,829,834 (GRCm39) V179I probably damaging Het
Nme4 C T 17: 26,314,410 (GRCm39) G6E possibly damaging Het
Nr1h4 T C 10: 89,319,311 (GRCm39) Y185C probably damaging Het
Nt5c3b T C 11: 100,327,012 (GRCm39) I95V probably benign Het
Ntaq1 A G 15: 58,004,913 (GRCm39) T9A probably benign Het
Or2y3 C T 17: 38,393,470 (GRCm39) R133H probably benign Het
Or5g9 A T 2: 85,552,145 (GRCm39) Y132F probably damaging Het
Or5t16 A T 2: 86,819,055 (GRCm39) I155N probably damaging Het
Pappa2 G T 1: 158,611,481 (GRCm39) P1494Q probably damaging Het
Pdzd2 A G 15: 12,457,909 (GRCm39) F144S probably benign Het
Phactr3 A G 2: 177,975,896 (GRCm39) H547R probably damaging Het
Pik3c2b T A 1: 133,018,588 (GRCm39) S1012T possibly damaging Het
Plppr2 G A 9: 21,859,107 (GRCm39) G408D probably damaging Het
Pom121 T A 5: 135,420,554 (GRCm39) N289I unknown Het
Ppa1 T A 10: 61,487,362 (GRCm39) S30T probably damaging Het
Rgs5 A T 1: 169,518,089 (GRCm39) K108* probably null Het
Rpap1 A G 2: 119,607,278 (GRCm39) V287A probably benign Het
Ryr1 A G 7: 28,774,664 (GRCm39) Y2326H probably damaging Het
Ryr2 A G 13: 11,707,599 (GRCm39) S2813P probably damaging Het
Sap25 T C 5: 137,640,702 (GRCm39) probably null Het
Senp5 T C 16: 31,782,279 (GRCm39) Y739C probably damaging Het
Slc25a29 A T 12: 108,793,017 (GRCm39) L187Q possibly damaging Het
Slc7a2 C T 8: 41,358,641 (GRCm39) T328M probably damaging Het
Slc7a8 T C 14: 55,018,759 (GRCm39) N9S probably benign Het
Snx18 A G 13: 113,754,039 (GRCm39) V298A probably benign Het
Spo11 T A 2: 172,833,904 (GRCm39) I342N possibly damaging Het
Ssc5d A G 7: 4,932,367 (GRCm39) K344E probably benign Het
Sspo A T 6: 48,439,269 (GRCm39) D1639V probably benign Het
Stk32b T C 5: 37,617,001 (GRCm39) D285G probably benign Het
Sult1b1 T C 5: 87,662,815 (GRCm39) D295G probably benign Het
Syt5 A G 7: 4,544,831 (GRCm39) L274P probably damaging Het
Tas1r2 T C 4: 139,396,208 (GRCm39) S545P possibly damaging Het
Tbc1d17 T G 7: 44,490,696 (GRCm39) D632A probably damaging Het
Tbc1d2 A G 4: 46,650,007 (GRCm39) S10P probably benign Het
Tlk1 A T 2: 70,555,908 (GRCm39) I417N probably damaging Het
Tmem184a C T 5: 139,791,984 (GRCm39) R348H possibly damaging Het
Togaram2 T A 17: 72,023,508 (GRCm39) V808D possibly damaging Het
Tpr A G 1: 150,324,939 (GRCm39) Q2397R probably benign Het
Trav7-4 A G 14: 53,698,994 (GRCm39) D47G possibly damaging Het
Usp17le T A 7: 104,419,814 (GRCm39) M35L probably benign Het
Vegfc C T 8: 54,633,829 (GRCm39) S262L probably benign Het
Vmn2r74 T A 7: 85,605,212 (GRCm39) I479L possibly damaging Het
Vps13a A T 19: 16,736,958 (GRCm39) F126L probably benign Het
Zfp945 C A 17: 23,070,582 (GRCm39) C460F possibly damaging Het
Zmym4 G T 4: 126,804,942 (GRCm39) S439R possibly damaging Het
Zscan4-ps3 A G 7: 11,344,093 (GRCm39) E17G probably damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 106,946,105 (GRCm39) missense possibly damaging 0.88
IGL00664:Bptf APN 11 106,968,491 (GRCm39) missense possibly damaging 0.78
IGL00705:Bptf APN 11 106,986,534 (GRCm39) splice site probably benign
IGL00796:Bptf APN 11 106,945,376 (GRCm39) missense probably damaging 1.00
IGL00834:Bptf APN 11 106,964,754 (GRCm39) missense possibly damaging 0.59
IGL01155:Bptf APN 11 106,971,553 (GRCm39) missense probably damaging 1.00
IGL01314:Bptf APN 11 106,945,679 (GRCm39) missense probably damaging 1.00
IGL01371:Bptf APN 11 106,946,733 (GRCm39) missense probably benign 0.00
IGL01567:Bptf APN 11 106,949,600 (GRCm39) missense probably damaging 1.00
IGL01794:Bptf APN 11 106,944,047 (GRCm39) critical splice donor site probably null
IGL02108:Bptf APN 11 106,965,814 (GRCm39) missense probably benign 0.45
IGL02367:Bptf APN 11 106,964,178 (GRCm39) missense probably benign
IGL02437:Bptf APN 11 106,965,521 (GRCm39) missense probably benign 0.00
IGL02589:Bptf APN 11 107,002,357 (GRCm39) missense possibly damaging 0.92
IGL02897:Bptf APN 11 106,937,947 (GRCm39) missense probably damaging 1.00
IGL02935:Bptf APN 11 106,971,625 (GRCm39) missense probably damaging 1.00
IGL02954:Bptf APN 11 106,945,575 (GRCm39) missense possibly damaging 0.89
IGL02982:Bptf APN 11 106,967,500 (GRCm39) missense probably damaging 1.00
IGL03109:Bptf APN 11 106,952,527 (GRCm39) missense possibly damaging 0.53
IGL03265:Bptf APN 11 106,945,454 (GRCm39) missense probably benign 0.00
IGL03403:Bptf APN 11 106,990,559 (GRCm39) missense possibly damaging 0.51
Anodyne UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
Arroyo UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
mojado UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
IGL03097:Bptf UTSW 11 106,968,506 (GRCm39) missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 106,945,614 (GRCm39) missense probably damaging 0.98
R0066:Bptf UTSW 11 106,952,962 (GRCm39) missense possibly damaging 0.90
R0157:Bptf UTSW 11 106,965,484 (GRCm39) missense possibly damaging 0.89
R0320:Bptf UTSW 11 106,963,645 (GRCm39) missense probably damaging 1.00
R0328:Bptf UTSW 11 106,937,953 (GRCm39) missense probably damaging 1.00
R0402:Bptf UTSW 11 106,964,940 (GRCm39) missense probably damaging 1.00
R0482:Bptf UTSW 11 106,972,088 (GRCm39) missense probably benign 0.13
R0574:Bptf UTSW 11 106,967,353 (GRCm39) missense probably damaging 1.00
R0598:Bptf UTSW 11 106,963,791 (GRCm39) missense probably damaging 0.99
R0599:Bptf UTSW 11 106,959,208 (GRCm39) missense probably damaging 1.00
R0601:Bptf UTSW 11 106,952,518 (GRCm39) missense probably benign 0.04
R0744:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0836:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0885:Bptf UTSW 11 106,934,617 (GRCm39) missense probably damaging 1.00
R1070:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1252:Bptf UTSW 11 106,964,077 (GRCm39) missense probably benign 0.00
R1370:Bptf UTSW 11 106,937,920 (GRCm39) missense probably damaging 0.99
R1428:Bptf UTSW 11 106,963,873 (GRCm39) missense probably damaging 0.99
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1742:Bptf UTSW 11 107,001,777 (GRCm39) missense probably damaging 1.00
R1816:Bptf UTSW 11 106,951,405 (GRCm39) missense probably damaging 1.00
R1858:Bptf UTSW 11 106,964,127 (GRCm39) missense probably benign 0.00
R1989:Bptf UTSW 11 106,965,652 (GRCm39) missense probably damaging 1.00
R2253:Bptf UTSW 11 107,002,148 (GRCm39) missense probably damaging 1.00
R2392:Bptf UTSW 11 106,963,573 (GRCm39) missense probably damaging 1.00
R2431:Bptf UTSW 11 106,938,066 (GRCm39) missense possibly damaging 0.48
R3022:Bptf UTSW 11 107,002,463 (GRCm39) critical splice acceptor site probably null
R3161:Bptf UTSW 11 106,965,302 (GRCm39) missense probably damaging 1.00
R3686:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3687:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3688:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3787:Bptf UTSW 11 106,964,653 (GRCm39) missense probably damaging 1.00
R3834:Bptf UTSW 11 106,964,683 (GRCm39) missense probably benign 0.05
R3885:Bptf UTSW 11 106,965,339 (GRCm39) missense probably damaging 0.97
R4090:Bptf UTSW 11 106,972,349 (GRCm39) missense probably damaging 0.99
R4398:Bptf UTSW 11 107,001,670 (GRCm39) missense probably damaging 1.00
R4437:Bptf UTSW 11 106,965,300 (GRCm39) missense possibly damaging 0.59
R4514:Bptf UTSW 11 106,968,518 (GRCm39) missense probably damaging 1.00
R4565:Bptf UTSW 11 106,963,836 (GRCm39) missense probably damaging 1.00
R4715:Bptf UTSW 11 106,938,007 (GRCm39) missense probably damaging 1.00
R4748:Bptf UTSW 11 106,986,706 (GRCm39) missense probably damaging 0.96
R4764:Bptf UTSW 11 106,934,520 (GRCm39) missense probably damaging 1.00
R4885:Bptf UTSW 11 106,965,474 (GRCm39) missense probably benign 0.39
R4901:Bptf UTSW 11 107,001,686 (GRCm39) nonsense probably null
R4995:Bptf UTSW 11 106,945,391 (GRCm39) missense probably damaging 0.98
R5057:Bptf UTSW 11 106,973,354 (GRCm39) missense probably damaging 0.98
R5120:Bptf UTSW 11 106,964,211 (GRCm39) missense probably damaging 0.99
R5320:Bptf UTSW 11 106,972,193 (GRCm39) nonsense probably null
R5329:Bptf UTSW 11 106,964,121 (GRCm39) missense probably benign 0.06
R5418:Bptf UTSW 11 107,002,120 (GRCm39) missense probably damaging 1.00
R5461:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R5664:Bptf UTSW 11 106,964,525 (GRCm39) missense probably benign 0.01
R5718:Bptf UTSW 11 107,002,260 (GRCm39) missense probably damaging 1.00
R5774:Bptf UTSW 11 107,001,963 (GRCm39) missense probably damaging 1.00
R5851:Bptf UTSW 11 107,001,688 (GRCm39) missense probably damaging 1.00
R5930:Bptf UTSW 11 106,964,022 (GRCm39) missense probably damaging 1.00
R5949:Bptf UTSW 11 107,001,915 (GRCm39) missense probably damaging 0.99
R5975:Bptf UTSW 11 106,926,690 (GRCm39) utr 3 prime probably benign
R6027:Bptf UTSW 11 106,965,771 (GRCm39) missense probably damaging 1.00
R6128:Bptf UTSW 11 106,965,516 (GRCm39) missense possibly damaging 0.87
R6337:Bptf UTSW 11 106,949,605 (GRCm39) missense possibly damaging 0.89
R6407:Bptf UTSW 11 107,001,952 (GRCm39) missense probably damaging 1.00
R6470:Bptf UTSW 11 106,963,593 (GRCm39) missense probably damaging 1.00
R6487:Bptf UTSW 11 106,968,552 (GRCm39) missense probably damaging 0.99
R6501:Bptf UTSW 11 106,968,509 (GRCm39) missense probably null 1.00
R6755:Bptf UTSW 11 106,938,082 (GRCm39) missense probably benign 0.27
R6861:Bptf UTSW 11 106,953,391 (GRCm39) missense probably damaging 1.00
R6866:Bptf UTSW 11 106,964,406 (GRCm39) missense probably damaging 1.00
R6879:Bptf UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
R6927:Bptf UTSW 11 106,945,421 (GRCm39) missense probably damaging 1.00
R6944:Bptf UTSW 11 106,971,649 (GRCm39) missense probably damaging 1.00
R7082:Bptf UTSW 11 106,977,573 (GRCm39) missense probably benign 0.00
R7136:Bptf UTSW 11 106,990,541 (GRCm39) missense probably damaging 1.00
R7162:Bptf UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
R7171:Bptf UTSW 11 107,022,233 (GRCm39) missense unknown
R7193:Bptf UTSW 11 106,945,635 (GRCm39) nonsense probably null
R7210:Bptf UTSW 11 106,945,290 (GRCm39) nonsense probably null
R7221:Bptf UTSW 11 106,945,658 (GRCm39) missense probably damaging 1.00
R7316:Bptf UTSW 11 107,001,740 (GRCm39) nonsense probably null
R7316:Bptf UTSW 11 106,963,935 (GRCm39) missense probably damaging 1.00
R7422:Bptf UTSW 11 106,951,384 (GRCm39) missense probably damaging 1.00
R7454:Bptf UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
R7657:Bptf UTSW 11 106,965,555 (GRCm39) missense probably damaging 1.00
R7718:Bptf UTSW 11 106,972,282 (GRCm39) missense possibly damaging 0.65
R7827:Bptf UTSW 11 106,938,013 (GRCm39) missense probably benign 0.01
R7844:Bptf UTSW 11 106,964,887 (GRCm39) missense probably damaging 0.97
R7992:Bptf UTSW 11 107,001,709 (GRCm39) missense probably benign 0.00
R8001:Bptf UTSW 11 106,938,166 (GRCm39) nonsense probably null
R8037:Bptf UTSW 11 106,946,776 (GRCm39) missense probably damaging 1.00
R8122:Bptf UTSW 11 106,927,417 (GRCm39) critical splice acceptor site probably null
R8235:Bptf UTSW 11 106,967,458 (GRCm39) missense probably benign 0.04
R8308:Bptf UTSW 11 106,943,815 (GRCm39) missense probably damaging 0.99
R8409:Bptf UTSW 11 106,953,495 (GRCm39) missense probably damaging 1.00
R8464:Bptf UTSW 11 107,022,168 (GRCm39) missense probably benign 0.01
R8477:Bptf UTSW 11 106,943,679 (GRCm39) missense probably damaging 0.98
R8482:Bptf UTSW 11 106,934,524 (GRCm39) missense probably benign 0.19
R8515:Bptf UTSW 11 106,946,064 (GRCm39) missense possibly damaging 0.85
R8519:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,140 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,139 (GRCm39) missense probably damaging 0.99
R8722:Bptf UTSW 11 107,022,295 (GRCm39) missense unknown
R8732:Bptf UTSW 11 106,931,206 (GRCm39) missense probably damaging 1.00
R8783:Bptf UTSW 11 107,022,357 (GRCm39) missense unknown
R8828:Bptf UTSW 11 106,945,836 (GRCm39) missense probably damaging 0.98
R9004:Bptf UTSW 11 106,945,713 (GRCm39) missense probably damaging 1.00
R9010:Bptf UTSW 11 106,964,576 (GRCm39) missense probably damaging 1.00
R9035:Bptf UTSW 11 106,963,842 (GRCm39) missense probably damaging 1.00
R9083:Bptf UTSW 11 106,959,176 (GRCm39) missense probably damaging 1.00
R9211:Bptf UTSW 11 106,946,124 (GRCm39) missense probably damaging 1.00
R9345:Bptf UTSW 11 106,971,588 (GRCm39) missense possibly damaging 0.77
R9393:Bptf UTSW 11 106,965,134 (GRCm39) missense probably benign 0.00
R9451:Bptf UTSW 11 106,935,411 (GRCm39) missense probably damaging 1.00
R9561:Bptf UTSW 11 106,964,954 (GRCm39) nonsense probably null
R9632:Bptf UTSW 11 106,952,545 (GRCm39) missense probably damaging 1.00
R9648:Bptf UTSW 11 106,943,720 (GRCm39) missense probably damaging 0.99
R9650:Bptf UTSW 11 106,935,412 (GRCm39) missense probably benign 0.15
R9658:Bptf UTSW 11 107,002,170 (GRCm39) missense probably damaging 1.00
R9775:Bptf UTSW 11 106,934,502 (GRCm39) missense probably benign 0.04
Z1088:Bptf UTSW 11 106,965,408 (GRCm39) missense probably benign 0.00
Z1176:Bptf UTSW 11 106,949,510 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATTCTGAGAAAACCATGCTTAC -3'
(R):5'- TTAGGGAATGATCATCTGCTTGTTC -3'

Sequencing Primer
(F):5'- ATGCTTACATGTGTTCACACTG -3'
(R):5'- CAGGTTACATAGGATGACATC -3'
Posted On 2022-11-14