Incidental Mutation 'R9777:Col24a1'
ID 733759
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 145021103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 491 (Y491*)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably null
Transcript: ENSMUST00000029848
AA Change: Y491*
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: Y491*

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A C 10: 10,283,214 (GRCm39) M164R possibly damaging Het
Alg10b T A 15: 90,111,656 (GRCm39) C167S probably benign Het
Ap2m1 C A 16: 20,358,113 (GRCm39) R44S probably damaging Het
Atrip T C 9: 108,902,964 (GRCm39) S37G probably benign Het
Bicra C T 7: 15,705,987 (GRCm39) V1485M probably benign Het
Brca2 C T 5: 150,480,579 (GRCm39) T2755I probably damaging Het
C1qtnf7 A T 5: 43,673,313 (GRCm39) probably benign Het
Ccdc7a C T 8: 129,618,860 (GRCm39) A895T possibly damaging Het
Cep290 T C 10: 100,354,529 (GRCm39) M871T probably benign Het
Col19a1 A G 1: 24,318,904 (GRCm39) V1062A unknown Het
Cyp2c66 A T 19: 39,102,520 (GRCm39) I50F probably benign Het
Dbn1 C A 13: 55,625,639 (GRCm39) R261L probably benign Het
Dlat G A 9: 50,562,208 (GRCm39) A272V probably damaging Het
Dlgap3 A T 4: 127,130,127 (GRCm39) E967V possibly damaging Het
Dnhd1 A G 7: 105,369,456 (GRCm39) M4360V probably benign Het
Dock7 C T 4: 98,877,464 (GRCm39) R1058Q unknown Het
Dpp4 T A 2: 62,195,340 (GRCm39) I313F probably benign Het
Dus1l C T 11: 120,683,858 (GRCm39) V197I possibly damaging Het
Eef2k TATTCATTCATTCATTCATTCATTCATTCA TATTCATTCATTCATTCATTCATTCA 7: 120,499,453 (GRCm39) probably benign Het
Fat3 A G 9: 15,826,537 (GRCm39) S324P probably benign Het
Fkbp9 C T 6: 56,855,181 (GRCm39) H567Y possibly damaging Het
Galnt10 C A 11: 57,672,065 (GRCm39) P452T probably damaging Het
Glb1 A T 9: 114,246,084 (GRCm39) D45V probably damaging Het
Grm1 A T 10: 10,573,826 (GRCm39) V904E possibly damaging Het
Gsdma3 T G 11: 98,526,071 (GRCm39) V274G probably damaging Het
Gsn A G 2: 35,194,600 (GRCm39) E681G probably damaging Het
Hpdl A G 4: 116,678,062 (GRCm39) L133P probably damaging Het
Ighv1-75 A G 12: 115,797,655 (GRCm39) L89P probably damaging Het
Igsf21 T A 4: 139,755,407 (GRCm39) Q416L probably damaging Het
Il23a G C 10: 128,132,829 (GRCm39) R143G probably benign Het
Ildr1 A G 16: 36,528,659 (GRCm39) T35A probably benign Het
Ints13 G T 6: 146,463,326 (GRCm39) H235Q probably damaging Het
Lama4 C T 10: 38,924,101 (GRCm39) T503I probably benign Het
Mapk13 T A 17: 28,997,075 (GRCm39) L289Q probably damaging Het
Med13l T C 5: 118,887,024 (GRCm39) S1642P probably benign Het
Megf6 T A 4: 154,343,617 (GRCm39) S713R probably damaging Het
Mical3 A G 6: 120,959,529 (GRCm39) V922A possibly damaging Het
Mug1 C T 6: 121,857,864 (GRCm39) T1119M probably damaging Het
Myo18a T A 11: 77,733,080 (GRCm39) M1370K possibly damaging Het
Ndufa12 A G 10: 94,056,692 (GRCm39) E140G probably damaging Het
Nek4 T A 14: 30,706,401 (GRCm39) D696E probably benign Het
Oas1f A G 5: 120,994,429 (GRCm39) T317A probably benign Het
Or14c39 T C 7: 86,343,988 (GRCm39) V108A probably benign Het
Or2r11 A G 6: 42,437,029 (GRCm39) I308T probably benign Het
Or6c210 T C 10: 129,495,705 (GRCm39) I10T probably benign Het
Pcdh17 C T 14: 84,683,683 (GRCm39) P50L probably benign Het
Pgs1 A G 11: 117,894,256 (GRCm39) E261G probably benign Het
Pira12 T G 7: 3,897,612 (GRCm39) R494S probably damaging Het
Ppp1r1a T C 15: 103,439,857 (GRCm39) E145G possibly damaging Het
Ppp1r37 T C 7: 19,295,783 (GRCm39) E58G probably benign Het
Ptprc A T 1: 138,047,901 (GRCm39) V77E Het
Rhag A G 17: 41,139,416 (GRCm39) E117G probably benign Het
Sh3d19 C T 3: 86,028,483 (GRCm39) S653L probably benign Het
Sirpd C A 3: 15,385,813 (GRCm39) E30* probably null Het
Slc35a5 C T 16: 44,972,939 (GRCm39) probably null Het
Smc4 C T 3: 68,929,655 (GRCm39) R510* probably null Het
Sorcs1 A G 19: 50,248,190 (GRCm39) probably null Het
Sp140 A G 1: 85,569,461 (GRCm39) N357S probably damaging Het
Spic T A 10: 88,514,421 (GRCm39) T60S possibly damaging Het
Steap1 C A 5: 5,786,517 (GRCm39) A307S probably benign Het
Stk3 A T 15: 35,114,791 (GRCm39) S40R probably damaging Het
Taar1 T C 10: 23,796,676 (GRCm39) C125R probably damaging Het
Tep1 T A 14: 51,076,443 (GRCm39) K1664* probably null Het
Tmem198b C A 10: 128,638,273 (GRCm39) V97L possibly damaging Het
Xirp2 C A 2: 67,347,379 (GRCm39) P3207T possibly damaging Het
Zbtb38 C G 9: 96,570,355 (GRCm39) S243T possibly damaging Het
Zbtb38 T A 9: 96,570,356 (GRCm39) S243C probably damaging Het
Zfp692 C T 11: 58,199,638 (GRCm39) R76W probably benign Het
Zwilch A T 9: 64,054,170 (GRCm39) L509H probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCTCACGGCAAATCTATAC -3'
(R):5'- CTGATGTCATCCGATGTGGC -3'

Sequencing Primer
(F):5'- TACACCAATGAGCTCATAGAAATGG -3'
(R):5'- GGGTACATTTCTTAAGCAGACCCAG -3'
Posted On 2022-11-14