Incidental Mutation 'R9777:Eef2k'
ID 733780
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9777 (G1)
Quality Score 128.467
Status Not validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TATTCATTCATTCATTCATTCATTCATTCA to TATTCATTCATTCATTCATTCATTCA at 120900230 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
AlphaFold O08796
Predicted Effect probably benign
Transcript: ENSMUST00000047875
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106487
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146482
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A C 10: 10,407,470 M164R possibly damaging Het
Alg10b T A 15: 90,227,453 C167S probably benign Het
Ap2m1 C A 16: 20,539,363 R44S probably damaging Het
Atrip T C 9: 109,073,896 S37G probably benign Het
Bicra C T 7: 15,972,062 V1485M probably benign Het
Brca2 C T 5: 150,557,114 T2755I probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
Ccdc7a C T 8: 128,892,379 A895T possibly damaging Het
Cep290 T C 10: 100,518,667 M871T probably benign Het
Col19a1 A G 1: 24,279,823 V1062A unknown Het
Col24a1 T A 3: 145,315,342 Y491* probably null Het
Cyp2c66 A T 19: 39,114,076 I50F probably benign Het
Dbn1 C A 13: 55,477,826 R261L probably benign Het
Dlat G A 9: 50,650,908 A272V probably damaging Het
Dlgap3 A T 4: 127,236,334 E967V possibly damaging Het
Dnhd1 A G 7: 105,720,249 M4360V probably benign Het
Dock7 C T 4: 98,989,227 R1058Q unknown Het
Dpp4 T A 2: 62,364,996 I313F probably benign Het
Dus1l C T 11: 120,793,032 V197I possibly damaging Het
Fat3 A G 9: 15,915,241 S324P probably benign Het
Fkbp9 C T 6: 56,878,196 H567Y possibly damaging Het
Galnt10 C A 11: 57,781,239 P452T probably damaging Het
Glb1 A T 9: 114,417,016 D45V probably damaging Het
Gm14548 T G 7: 3,894,613 R494S probably damaging Het
Gm9733 C A 3: 15,320,753 E30* probably null Het
Grm1 A T 10: 10,698,082 V904E possibly damaging Het
Gsdma3 T G 11: 98,635,245 V274G probably damaging Het
Gsn A G 2: 35,304,588 E681G probably damaging Het
Hpdl A G 4: 116,820,865 L133P probably damaging Het
Ighv1-75 A G 12: 115,834,035 L89P probably damaging Het
Igsf21 T A 4: 140,028,096 Q416L probably damaging Het
Il23a G C 10: 128,296,960 R143G probably benign Het
Ildr1 A G 16: 36,708,297 T35A probably benign Het
Ints13 G T 6: 146,561,828 H235Q probably damaging Het
Lama4 C T 10: 39,048,105 T503I probably benign Het
Mapk13 T A 17: 28,778,101 L289Q probably damaging Het
Med13l T C 5: 118,748,959 S1642P probably benign Het
Megf6 T A 4: 154,259,160 S713R probably damaging Het
Mical3 A G 6: 120,982,568 V922A possibly damaging Het
Mug1 C T 6: 121,880,905 T1119M probably damaging Het
Myo18a T A 11: 77,842,254 M1370K possibly damaging Het
Ndufa12 A G 10: 94,220,830 E140G probably damaging Het
Nek4 T A 14: 30,984,444 D696E probably benign Het
Oas1f A G 5: 120,856,366 T317A probably benign Het
Olfr292 T C 7: 86,694,780 V108A probably benign Het
Olfr458 A G 6: 42,460,095 I308T probably benign Het
Olfr800 T C 10: 129,659,836 I10T probably benign Het
Pcdh17 C T 14: 84,446,243 P50L probably benign Het
Pgs1 A G 11: 118,003,430 E261G probably benign Het
Ppp1r1a T C 15: 103,531,430 E145G possibly damaging Het
Ppp1r37 T C 7: 19,561,858 E58G probably benign Het
Ptprc A T 1: 138,120,163 V77E Het
Rhag A G 17: 40,828,525 E117G probably benign Het
Sh3d19 C T 3: 86,121,176 S653L probably benign Het
Slc35a5 C T 16: 45,152,576 probably null Het
Smc4 C T 3: 69,022,322 R510* probably null Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sp140 A G 1: 85,641,740 N357S probably damaging Het
Spic T A 10: 88,678,559 T60S possibly damaging Het
Steap1 C A 5: 5,736,517 A307S probably benign Het
Stk3 A T 15: 35,114,645 S40R probably damaging Het
Taar1 T C 10: 23,920,778 C125R probably damaging Het
Tep1 T A 14: 50,838,986 K1664* probably null Het
Tmem198b C A 10: 128,802,404 V97L possibly damaging Het
Xirp2 C A 2: 67,517,035 P3207T possibly damaging Het
Zbtb38 C G 9: 96,688,302 S243T possibly damaging Het
Zbtb38 T A 9: 96,688,303 S243C probably damaging Het
Zfp692 C T 11: 58,308,812 R76W probably benign Het
Zwilch A T 9: 64,146,888 L509H probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACGTGGCAGTGAGGTGG -3'
(R):5'- ATGACCTCAGACCCCTCCT -3'

Sequencing Primer
(F):5'- GAGGGGGCAGAGAGAGACCTAC -3'
(R):5'- ACCTGGAGCTTGCTAAATCAG -3'
Posted On 2022-11-14