Mutagenetix > Incidental Mutation

Incidental Mutation 'R9778:Thbs4'

733862

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9778 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92776987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 142 (S142P)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: S142P

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: S142P

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	A	T	8: 124,639,359	I215N	probably damaging	Het
Aig1	T	C	10: 13,653,013		probably null	Het
Atp8b2	T	A	3: 89,954,558	K82N	possibly damaging	Het
Cacnb4	T	G	2: 52,469,603	Y131S	probably damaging	Het
Cep170b	G	A	12: 112,731,430	S62N	possibly damaging	Het
Crmp1	A	G	5: 37,265,275	D142G	probably benign	Het
Csf1r	A	G	18: 61,127,885	Q716R	possibly damaging	Het
Cyp2u1	T	C	3: 131,293,484	T483A	possibly damaging	Het
D930020B18Rik	T	C	10: 121,667,660	F247L	probably benign	Het
Dcaf13	T	C	15: 39,145,191	L396P	probably damaging	Het
Dnhd1	A	G	7: 105,704,033	M2798V	probably benign	Het
E030018B13Rik	A	T	7: 63,919,377	T58S	unknown	Het
Eipr1	T	C	12: 28,847,658		probably null	Het
Elf1	C	T	14: 79,580,508	T526M	possibly damaging	Het
Gm30302	C	T	13: 49,786,066	V723M	possibly damaging	Het
Gm35339	T	A	15: 76,356,925	F574I		Het
Gm8369	GTGTGTGTGTGTGTGTGTGTG	GTGTGTGTGTGTGTGTGTGTGTG	19: 11,511,764		probably null	Het
Got1	A	G	19: 43,515,845	S46P	probably benign	Het
Inpp4b	T	C	8: 82,048,531	I786T	probably benign	Het
Kdm1a	T	C	4: 136,552,581	I703M	probably damaging	Het
Krt222	A	T	11: 99,235,012	S264R	probably benign	Het
Lrrd1	A	C	5: 3,849,982	S96R	possibly damaging	Het
Ltb	C	A	17: 35,195,930	Y235*	probably null	Het
Mbd2	T	A	18: 70,617,979	C362S	probably damaging	Het
Mlycd	T	A	8: 119,402,586	I264N	probably damaging	Het
Mri1	C	T	8: 84,254,304	C199Y	possibly damaging	Het
Muc5ac	A	T	7: 141,795,284	K487*	probably null	Het
Myh13	T	C	11: 67,358,190	I1274T	probably damaging	Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncf1	T	A	5: 134,229,590		probably benign	Het
Nipbl	C	A	15: 8,291,548	A2692S	probably benign	Het
Odf2l	C	T	3: 145,149,028	T542I	possibly damaging	Het
Olfr118	T	A	17: 37,672,254	I77N	probably damaging	Het
Olfr517	A	G	7: 108,868,491	I221T	probably damaging	Het
Oxsm	T	C	14: 16,242,629	T47A	possibly damaging	Het
Pcdhga3	A	T	18: 37,674,733	S80C	probably benign	Het
Pcnx2	T	C	8: 125,785,437	T1377A	probably benign	Het
Phactr3	C	A	2: 178,283,012	Q252K	possibly damaging	Het
Phf2	T	C	13: 48,819,625	H385R	unknown	Het
Pkd1l3	A	T	8: 109,631,305	T820S	probably benign	Het
Plekhg1	T	A	10: 3,937,966	H353Q		Het
Prss37	T	A	6: 40,517,779	E24V	probably damaging	Het
Reln	A	G	5: 21,950,945	F2183S	probably damaging	Het
Slc20a2	A	G	8: 22,561,391	D480G	probably damaging	Het
Slc8a2	C	T	7: 16,153,199	T672M	probably damaging	Het
Slf2	A	G	19: 44,973,227	T1062A	probably benign	Het
Snx29	A	G	16: 11,405,745	E18G	possibly damaging	Het
Srf	C	A	17: 46,549,153	G482V	possibly damaging	Het
Styk1	G	A	6: 131,311,029	Q124*	probably null	Het
Tcf7l1	G	T	6: 72,631,243	A385E	probably damaging	Het
Tlr1	G	A	5: 64,926,028	S402F	probably damaging	Het
Tnrc6a	A	G	7: 123,170,412	H475R	probably benign	Het
Trmt10b	A	T	4: 45,314,374	N272I	probably damaging	Het
Ubxn7	A	T	16: 32,381,653	N409I	probably benign	Het
Vcan	T	C	13: 89,689,811	E2538G	probably damaging	Het
Vmn1r65	C	T	7: 6,008,388	W282*	probably null	Het
Vmn2r4	A	G	3: 64,415,076	I74T	probably benign	Het
Zfp949	T	C	9: 88,567,287		probably null	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATGAGCTGACACACTTTCC -3'
(R):5'- ACTTTGCCCAGGACCATGTC -3'

Sequencing Primer
(F):5'- CAGCACGGACCTGGAAACTTTG -3'
(R):5'- GGACCATGTCCCTTGCTC -3'

Posted On

2022-11-14