Incidental Mutation 'R9779:Ticrr'
ID 733909
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R9779 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79679054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
AA Change: D647G

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: D647G

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect possibly damaging
Transcript: ENSMUST00000206591
AA Change: D647G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
AA Change: D647G

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,201,302 T1021K possibly damaging Het
Aff4 T G 11: 53,372,907 Y251* probably null Het
Amdhd1 G T 10: 93,534,612 F121L possibly damaging Het
Apon A T 10: 128,255,196 T248S probably benign Het
Arhgap28 A T 17: 67,845,769 I719K probably benign Het
Atf7ip2 A T 16: 10,237,180 K270N possibly damaging Het
Atp2c1 A G 9: 105,414,720 V881A probably damaging Het
Atp6v0a1 C T 11: 101,034,112 T341M probably damaging Het
Cep192 T C 18: 67,835,277 V944A probably damaging Het
Cyp26b1 T C 6: 84,575,131 T342A probably benign Het
Cyp2c37 A G 19: 40,009,879 E405G probably benign Het
Dab2 T C 15: 6,431,044 S478P probably benign Het
Diablo A G 5: 123,524,069 probably null Het
Dirc2 T C 16: 35,722,816 D316G probably benign Het
Dnajc8 A G 4: 132,550,426 E174G possibly damaging Het
E430018J23Rik A T 7: 127,392,297 C173S probably damaging Het
Eif4g1 T C 16: 20,679,501 V336A probably damaging Het
Eif5a C T 11: 69,919,195 V41I probably benign Het
Epb41l5 C T 1: 119,617,363 probably null Het
F12 A C 13: 55,418,199 V565G probably damaging Het
Fras1 C A 5: 96,569,494 T389N probably damaging Het
Galnt13 T A 2: 54,733,050 D69E probably benign Het
Gm14124 A G 2: 150,266,144 D8G possibly damaging Het
Golph3l C T 3: 95,591,730 T61I probably damaging Het
Grm3 A T 5: 9,511,656 N731K possibly damaging Het
Hmgxb4 C T 8: 75,024,001 S484F possibly damaging Het
Hsd17b11 C A 5: 104,009,905 V114F probably damaging Het
Hspa1a C T 17: 34,971,802 V42M probably damaging Het
Igf1r A G 7: 68,004,317 Y201C probably damaging Het
Inf2 C A 12: 112,608,352 P786T unknown Het
Ints12 T G 3: 133,106,991 V236G probably benign Het
Itga2b T C 11: 102,457,321 N818S probably damaging Het
Itgb4 T C 11: 115,991,659 L853P probably damaging Het
Kap A G 6: 133,852,043 V42A probably benign Het
Kcnk1 T C 8: 126,025,068 S138P probably damaging Het
Klra2 G A 6: 131,221,838 P247S unknown Het
Lrba T C 3: 86,325,771 I813T probably damaging Het
Lrrc27 A T 7: 139,236,970 Q428L possibly damaging Het
Macf1 G A 4: 123,454,996 T4046I probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Meox1 T C 11: 101,878,644 E242G probably benign Het
Neo1 A T 9: 58,978,726 L316* probably null Het
Notch3 A G 17: 32,153,783 Y605H probably damaging Het
Nsf T C 11: 103,828,526 D650G probably damaging Het
Obscn C A 11: 59,135,615 R254L probably benign Het
Odam G A 5: 87,889,468 probably null Het
Olfr111 A T 17: 37,530,157 Y60F probably damaging Het
Olfr834 A T 9: 18,988,839 M284L probably benign Het
Park2 T C 17: 11,635,431 S285P possibly damaging Het
Pcdhb9 A T 18: 37,402,200 M416L probably benign Het
Plcz1 A T 6: 140,002,156 I500N possibly damaging Het
Rab14 G A 2: 35,190,035 T50I Het
Rag1 A T 2: 101,643,808 Y330N probably damaging Het
Rapgef3 T C 15: 97,745,598 I911V probably damaging Het
Rasgrf1 G T 9: 89,991,498 C620F probably damaging Het
Rhbdl3 A G 11: 80,323,491 T143A probably damaging Het
Robo2 A C 16: 73,971,077 M609R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sod3 G A 5: 52,368,093 V45I probably benign Het
Tmem119 G A 5: 113,795,143 S199L possibly damaging Het
Tmem63c T A 12: 87,057,645 I80N probably damaging Het
Trp53bp1 A T 2: 121,235,988 D752E probably damaging Het
Ttn A G 2: 76,720,226 S31571P probably damaging Het
Ttn A T 2: 76,836,802 S11487T unknown Het
Vmn1r123 T C 7: 21,162,186 M1T probably null Het
Vmn1r85 A T 7: 13,084,381 S279T probably benign Het
Vps13d A G 4: 145,072,402 V3635A Het
Wdr95 A G 5: 149,581,828 D358G probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGGAACATTTCACG -3'
(R):5'- AGGATGTGCACTAAACCCAC -3'

Sequencing Primer
(F):5'- ACTGTGGAACATTTCACGTCATC -3'
(R):5'- CCAACCATCAAACACTACATTTATGG -3'
Posted On 2022-11-14