Incidental Mutation 'R9780:Lcp1'
ID 734004
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9780 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75440178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 154 (F154S)
Ref Sequence ENSEMBL: ENSMUSP00000121201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000143539] [ENSMUST00000145303]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000122840
SMART Domains Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124499
AA Change: F154S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: F154S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125833
SMART Domains Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131802
AA Change: F154S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: F154S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134114
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145303
AA Change: F154S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: F154S

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,911,447 (GRCm39) T1344A probably benign Het
Actrt3 T A 3: 30,652,876 (GRCm39) I73F probably damaging Het
Ankrd24 T C 10: 81,482,196 (GRCm39) S915P possibly damaging Het
Ano1 A T 7: 144,209,358 (GRCm39) F281I probably damaging Het
Arhgap42 A G 9: 9,059,102 (GRCm39) V148A probably benign Het
Arnt2 A G 7: 83,954,426 (GRCm39) I256T probably benign Het
Bloc1s3 G A 7: 19,241,408 (GRCm39) S40L possibly damaging Het
Cep68 G A 11: 20,192,142 (GRCm39) P19L probably benign Het
Chst9 T A 18: 15,586,221 (GRCm39) Q114L probably benign Het
Cpa2 T A 6: 30,545,536 (GRCm39) F106I probably benign Het
Cplane1 A G 15: 8,258,123 (GRCm39) E2123G probably benign Het
Crocc T C 4: 140,756,556 (GRCm39) D1187G probably benign Het
Dhx8 A T 11: 101,632,403 (GRCm39) D454V possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Eif3a A T 19: 60,766,398 (GRCm39) L310H probably damaging Het
Ergic3 C A 2: 155,853,164 (GRCm39) Y202* probably null Het
Fam117a A T 11: 95,268,309 (GRCm39) I237L possibly damaging Het
Fcsk T C 8: 111,613,743 (GRCm39) M773V probably benign Het
Gcnt4 T A 13: 97,083,948 (GRCm39) S415T probably benign Het
Hacl1 C A 14: 31,362,519 (GRCm39) V43L possibly damaging Het
Hbb-bh2 A G 7: 103,489,624 (GRCm39) L4P probably damaging Het
Hmbs A G 9: 44,247,985 (GRCm39) L357P probably damaging Het
Hpcal1 A G 12: 17,836,494 (GRCm39) Y108C probably damaging Het
Hspa14 A T 2: 3,490,741 (GRCm39) M482K probably damaging Het
Ifi27l2b G T 12: 103,417,461 (GRCm39) P242Q unknown Het
Insyn1 A G 9: 58,406,881 (GRCm39) N264D probably damaging Het
Itpr1 T C 6: 108,487,795 (GRCm39) V2407A probably benign Het
Lmod2 T C 6: 24,604,233 (GRCm39) S403P probably damaging Het
Lrrc63 G A 14: 75,360,500 (GRCm39) A334V probably damaging Het
Lrriq1 T A 10: 103,025,824 (GRCm39) T933S probably damaging Het
Mga A G 2: 119,747,253 (GRCm39) Y468C probably benign Het
Msh4 T C 3: 153,582,342 (GRCm39) Y510C probably damaging Het
Myh11 T C 16: 14,064,613 (GRCm39) K235R Het
Nek2 A T 1: 191,554,738 (GRCm39) D150V probably damaging Het
Nfkbil1 C A 17: 35,439,898 (GRCm39) R205L possibly damaging Het
Nox3 A G 17: 3,736,260 (GRCm39) F122S possibly damaging Het
Nrxn1 A G 17: 90,931,042 (GRCm39) V718A possibly damaging Het
Oplah A G 15: 76,181,940 (GRCm39) I1061T probably damaging Het
Or13e8 G A 4: 43,697,193 (GRCm39) probably benign Het
Or2y16 G A 11: 49,335,014 (GRCm39) C112Y possibly damaging Het
Or51b17 A G 7: 103,542,631 (GRCm39) S104P probably damaging Het
Or9m1 A G 2: 87,733,426 (GRCm39) L198P probably damaging Het
Pcf11 A T 7: 92,313,313 (GRCm39) D123E possibly damaging Het
Pcna C T 2: 132,094,794 (GRCm39) E55K probably benign Het
Pip5k1c T C 10: 81,141,030 (GRCm39) V46A probably benign Het
Plce1 T G 19: 38,609,134 (GRCm39) L481R possibly damaging Het
Psma7 A T 2: 179,678,339 (GRCm39) Y228N unknown Het
Rcbtb1 T A 14: 59,465,796 (GRCm39) Y380N probably benign Het
Rin2 A T 2: 145,718,551 (GRCm39) E677V probably damaging Het
Scgb2b11 A G 7: 31,909,861 (GRCm39) L75P probably damaging Het
Scn4a A G 11: 106,226,235 (GRCm39) V775A probably damaging Het
Setx A G 2: 29,016,999 (GRCm39) D34G possibly damaging Het
Slc38a9 A T 13: 112,862,591 (GRCm39) D430V probably damaging Het
Snapc4 A T 2: 26,267,019 (GRCm39) N77K possibly damaging Het
Stk32a T G 18: 43,375,049 (GRCm39) F20V probably benign Het
Taf1b G A 12: 24,564,818 (GRCm39) G145D probably damaging Het
Tomt G C 7: 101,549,536 (GRCm39) Q251E probably benign Het
Tsc1 G A 2: 28,565,761 (GRCm39) E471K probably damaging Het
Ttll9 G A 2: 152,836,023 (GRCm39) A256T possibly damaging Het
Ttn A T 2: 76,774,289 (GRCm39) C2252S probably benign Het
Ttn A T 2: 76,785,035 (GRCm39) D797E unknown Het
Usf3 T A 16: 44,039,181 (GRCm39) N1220K possibly damaging Het
Usp22 A T 11: 61,050,069 (GRCm39) H355Q probably benign Het
Virma T A 4: 11,513,442 (GRCm39) V432E possibly damaging Het
Vtn A C 11: 78,393,003 (GRCm39) D456A probably damaging Het
Zbbx A G 3: 74,945,359 (GRCm39) S688P probably damaging Het
Zfhx2 C A 14: 55,312,494 (GRCm39) D67Y probably benign Het
Zfp87 T C 13: 67,665,241 (GRCm39) H407R probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGATGTTGGCCTGGCAG -3'
(R):5'- GAGGTTAGTTTACTCCCCTGTAC -3'

Sequencing Primer
(F):5'- CATGAGAATGTGGGGTCCATG -3'
(R):5'- CCCTATCAAGTGGATTCCGTTAAGG -3'
Posted On 2022-11-14