Incidental Mutation 'R9782:Hfm1'
ID 734106
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9782 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107021896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1013 (E1013G)
Ref Sequence ENSEMBL: ENSMUSP00000108310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: E1013G

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: E1013G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: E1013G

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: E1013G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: E226G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,053,796 (GRCm39) M1K probably null Het
Atoh8 A T 6: 72,200,848 (GRCm39) L281M possibly damaging Het
Bckdha A G 7: 25,340,880 (GRCm39) probably null Het
Chil6 A T 3: 106,296,121 (GRCm39) Y371* probably null Het
Cilk1 A T 9: 78,048,520 (GRCm39) Q108L probably damaging Het
Fbxw18 G T 9: 109,522,376 (GRCm39) H164Q probably benign Het
Gucd1 T G 10: 75,345,650 (GRCm39) D135A probably benign Het
Hacd1 A G 2: 14,040,751 (GRCm39) I168T possibly damaging Het
Hsf4 G A 8: 105,999,217 (GRCm39) probably null Het
Ift140 G T 17: 25,264,151 (GRCm39) probably null Het
Igsf3 A T 3: 101,338,612 (GRCm39) I309F probably benign Het
Imp4 T A 1: 34,482,901 (GRCm39) L164Q probably damaging Het
Jazf1 C T 6: 52,747,311 (GRCm39) V204I probably benign Het
Kmt2d T A 15: 98,764,597 (GRCm39) D2V probably damaging Het
Knl1 T C 2: 118,899,910 (GRCm39) V537A probably benign Het
Mep1b A T 18: 21,208,720 (GRCm39) D32V possibly damaging Het
Mki67 A G 7: 135,306,066 (GRCm39) probably null Het
Morn3 C T 5: 123,175,822 (GRCm39) V189M probably damaging Het
Mri1 C T 8: 84,980,933 (GRCm39) C199Y possibly damaging Het
Mtmr2 T C 9: 13,713,293 (GRCm39) M490T probably benign Het
Muc16 T C 9: 18,548,066 (GRCm39) T6076A possibly damaging Het
Myo1c A G 11: 75,549,273 (GRCm39) E113G probably damaging Het
Nat8f4 A T 6: 85,878,052 (GRCm39) V157D probably damaging Het
Nectin4 T C 1: 171,214,192 (GRCm39) V449A probably damaging Het
Ogdhl C T 14: 32,061,909 (GRCm39) T528M probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 G A 2: 88,356,835 (GRCm39) V303M probably benign Het
Or52l1 A G 7: 104,830,067 (GRCm39) V166A probably damaging Het
Pcdhb12 AT A 18: 37,570,393 (GRCm39) probably null Het
Pigo T C 4: 43,023,475 (GRCm39) D233G probably damaging Het
Pkn2 A C 3: 142,516,237 (GRCm39) V562G possibly damaging Het
Plxna1 C A 6: 89,333,817 (GRCm39) A271S probably benign Het
Ppp1r3a C T 6: 14,718,766 (GRCm39) S716N probably damaging Het
Prss12 G A 3: 123,271,762 (GRCm39) G256S probably benign Het
Psg28 A T 7: 18,164,331 (GRCm39) M127K probably benign Het
Psmf1 T C 2: 151,577,533 (GRCm39) D48G possibly damaging Het
Rabggta T A 14: 55,955,944 (GRCm39) M438L possibly damaging Het
Rapgef3 T C 15: 97,643,479 (GRCm39) I911V probably damaging Het
Rbck1 T C 2: 152,165,113 (GRCm39) E297G probably damaging Het
Rras A T 7: 44,669,945 (GRCm39) I126F probably damaging Het
Slc22a28 T C 19: 8,041,813 (GRCm39) R465G probably null Het
Slc28a2b T A 2: 122,352,338 (GRCm39) I365N probably damaging Het
Snx19 A G 9: 30,340,172 (GRCm39) T437A probably benign Het
Son A T 16: 91,444,838 (GRCm39) S15C probably damaging Het
Spata31e1 C T 13: 49,939,542 (GRCm39) V723M possibly damaging Het
Sptbn4 G T 7: 27,107,993 (GRCm39) Q810K probably benign Het
Tmtc2 T C 10: 105,026,062 (GRCm39) Y802C probably damaging Het
Trrap T A 5: 144,758,716 (GRCm39) M2181K probably damaging Het
Ttc23l A G 15: 10,530,767 (GRCm39) S282P probably damaging Het
Zbtb7a G A 10: 80,979,910 (GRCm39) D35N probably damaging Het
Zc3h3 C A 15: 75,681,489 (GRCm39) V531L probably damaging Het
Zfhx4 A G 3: 5,466,514 (GRCm39) D2249G probably benign Het
Zfp87 T C 13: 74,520,932 (GRCm39) K49E probably benign Het
Zfp942 T C 17: 22,147,463 (GRCm39) T389A probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCCCACTGTTACACCAG -3'
(R):5'- GCCGAAGTATGAGCTTGAGGTG -3'

Sequencing Primer
(F):5'- CCCACTGTTACACCAGGAAAC -3'
(R):5'- TGGAGCAGGTGAATATTCTGAC -3'
Posted On 2022-11-14