Incidental Mutation 'R9784:Col9a2'
ID 734198
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9784 (G1)
Quality Score 174.009
Status Not validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120898226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 46 (D46V)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000030372
AA Change: D46V
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: D46V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,338,527 (GRCm39) P495L possibly damaging Het
Acly C T 11: 100,389,112 (GRCm39) A557T probably benign Het
Adgrl4 A T 3: 151,214,948 (GRCm39) T446S probably damaging Het
AK157302 A G 13: 21,679,768 (GRCm39) E98G probably damaging Het
Akap6 A T 12: 53,187,853 (GRCm39) T1756S probably damaging Het
Aldh1l1 A G 6: 90,541,424 (GRCm39) T273A probably benign Het
Aldh1l2 T A 10: 83,342,614 (GRCm39) probably null Het
Alox12 T C 11: 70,143,665 (GRCm39) E201G possibly damaging Het
Arhgef16 A G 4: 154,371,422 (GRCm39) V257A probably damaging Het
Asxl3 C T 18: 22,650,311 (GRCm39) L767F probably benign Het
Atxn7l2 T C 3: 108,110,565 (GRCm39) K692R probably null Het
Btbd2 T C 10: 80,484,481 (GRCm39) D145G probably damaging Het
Cacna1b A T 2: 24,651,801 (GRCm39) M126K possibly damaging Het
Cacna2d2 T A 9: 107,404,346 (GRCm39) C1081S probably benign Het
Cass4 T C 2: 172,269,753 (GRCm39) S612P probably benign Het
Cd209d A G 8: 3,926,337 (GRCm39) S123P probably damaging Het
Cep112 T C 11: 108,461,217 (GRCm39) S665P probably damaging Het
Cnp C T 11: 100,467,437 (GRCm39) R127W probably damaging Het
Cyp1a2 T A 9: 57,587,562 (GRCm39) N336I probably benign Het
Cyp2c37 A G 19: 39,988,943 (GRCm39) T301A possibly damaging Het
Dhtkd1 T A 2: 5,935,622 (GRCm39) E163D probably benign Het
Dido1 A T 2: 180,325,354 (GRCm39) F611L probably benign Het
Dnah9 T A 11: 65,975,960 (GRCm39) N1363I probably damaging Het
Drg2 A G 11: 60,358,548 (GRCm39) K331R probably benign Het
Fam171b T A 2: 83,690,787 (GRCm39) I250K probably damaging Het
Fem1al A T 11: 29,775,253 (GRCm39) V68E probably damaging Het
Fut8 T A 12: 77,459,613 (GRCm39) I242N probably damaging Het
Glyat T C 19: 12,628,844 (GRCm39) V247A probably benign Het
Gucy2e T C 11: 69,123,516 (GRCm39) N461S probably benign Het
Hif3a T A 7: 16,771,076 (GRCm39) H627L probably benign Het
Ighv8-5 T A 12: 115,031,228 (GRCm39) T104S probably benign Het
Ighv8-9 C T 12: 115,431,994 (GRCm39) V106M probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Katna1 G C 10: 7,638,590 (GRCm39) E440D probably null Het
Kmt2c T C 5: 25,549,959 (GRCm39) R1341G probably damaging Het
Krt14 C T 11: 100,097,966 (GRCm39) G106S unknown Het
Krt39 A G 11: 99,409,188 (GRCm39) C238R possibly damaging Het
Mak C T 13: 41,202,836 (GRCm39) S204N possibly damaging Het
Map3k5 A G 10: 19,810,812 (GRCm39) Y154C probably damaging Het
Mgam A G 6: 40,736,024 (GRCm39) Y841C probably damaging Het
Mgst1 A T 6: 138,124,799 (GRCm39) R38W probably damaging Het
Midn A G 10: 79,992,247 (GRCm39) E433G probably damaging Het
Muc2 T A 7: 141,280,785 (GRCm39) C380* probably null Het
Nans G T 4: 46,499,129 (GRCm39) K145N possibly damaging Het
Nbeal1 G A 1: 60,299,741 (GRCm39) W1359* probably null Het
Neo1 T A 9: 58,889,503 (GRCm39) E256V probably benign Het
Nkd1 C A 8: 89,318,330 (GRCm39) D322E probably damaging Het
Olfm4 T C 14: 80,249,348 (GRCm39) V155A probably damaging Het
Opa1 C A 16: 29,437,029 (GRCm39) S646* probably null Het
Or1p4-ps1 G T 11: 74,208,709 (GRCm39) C286F unknown Het
Or4f7 A G 2: 111,644,604 (GRCm39) S156P probably damaging Het
Or51ab3 T A 7: 103,201,266 (GRCm39) H91Q probably benign Het
Or52z1 T A 7: 103,436,732 (GRCm39) I251F probably benign Het
Or5b107 T A 19: 13,142,813 (GRCm39) L145Q probably damaging Het
Or5b12b G A 19: 12,861,874 (GRCm39) V210M probably benign Het
Or7g29 A T 9: 19,287,116 (GRCm39) D20E probably damaging Het
Pcdh15 A T 10: 74,467,212 (GRCm39) H1743L probably benign Het
Ppp1r13b T C 12: 111,810,119 (GRCm39) T230A probably benign Het
Ptf1a G T 2: 19,451,381 (GRCm39) R237L probably benign Het
Ripk4 G A 16: 97,549,306 (GRCm39) P250L possibly damaging Het
Ropn1l T C 15: 31,453,649 (GRCm39) H14R Het
Setdb1 T C 3: 95,233,173 (GRCm39) S1122G probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc22a18 T A 7: 143,046,678 (GRCm39) M274K probably benign Het
Spink5 T G 18: 44,119,490 (GRCm39) F267C probably damaging Het
Stau1 T C 2: 166,791,695 (GRCm39) M481V probably benign Het
Stk39 C T 2: 68,198,775 (GRCm39) G281E probably damaging Het
Stt3a A T 9: 36,670,079 (GRCm39) L119Q probably damaging Het
Stx18 C T 5: 38,196,635 (GRCm39) probably benign Het
Tgfbr3 G T 5: 107,297,799 (GRCm39) N200K probably benign Het
Timm8b A G 9: 50,516,273 (GRCm39) E42G probably benign Het
Togaram1 T A 12: 65,014,168 (GRCm39) L473* probably null Het
Trappc12 A G 12: 28,797,457 (GRCm39) I25T probably benign Het
Trim33 T C 3: 103,244,823 (GRCm39) S737P possibly damaging Het
Trmt1 A C 8: 85,424,330 (GRCm39) H455P probably damaging Het
Trpc1 C T 9: 95,599,646 (GRCm39) R471H possibly damaging Het
Ttll2 T A 17: 7,618,707 (GRCm39) T407S probably benign Het
Unc45b T A 11: 82,816,986 (GRCm39) N475K probably damaging Het
Usp48 T A 4: 137,321,812 (GRCm39) I40N probably benign Het
Wdr7 T G 18: 64,037,236 (GRCm39) V1220G probably damaging Het
Zfp830 C T 11: 82,655,805 (GRCm39) T203I possibly damaging Het
Zfp955a T A 17: 33,461,149 (GRCm39) I328F probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAGCACCATCTCCTTGG -3'
(R):5'- ATAAGGACACGCTGTGAGC -3'

Sequencing Primer
(F):5'- GGGAGATGCTGCCCTAGTCAC -3'
(R):5'- GGTGGTTTTGACAGACTCCCAC -3'
Posted On 2022-11-14