Mutagenetix > Incidental Mutation

Incidental Mutation 'R9786:Kmt2e'

734323

Institutional Source

Beutler Lab

Gene Symbol

Kmt2e

Ensembl Gene

ENSMUSG00000029004

Gene Name

lysine (K)-specific methyltransferase 2E

Synonyms

D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9786 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23434441-23504235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23497984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1054 (D1054G)

Ref Sequence

ENSEMBL: ENSMUSP00000092569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000126586] [ENSMUST00000146375] [ENSMUST00000196260]

AlphaFold

Q3UG20

Predicted Effect

probably benign
Transcript: ENSMUST00000094962
AA Change: D1054G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: D1054G

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000115128
AA Change: D1054G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: D1054G

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000126586

Predicted Effect

probably benign
Transcript: ENSMUST00000146375

SMART Domains

Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

Domain	Start	End	E-Value	Type
low complexity region	104	117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194010

Predicted Effect

probably benign
Transcript: ENSMUST00000196260

SMART Domains

Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,684	D441N	possibly damaging	Het
A4gnt	T	A	9: 99,620,483	M232K	possibly damaging	Het
Abcc1	T	C	16: 14,405,063	S243P	probably damaging	Het
Acsl1	T	C	8: 46,521,449	Y320H	probably damaging	Het
Adam11	A	G	11: 102,762,264	S61G	probably benign	Het
Adamts1	G	A	16: 85,795,414	T965I	probably benign	Het
Adcyap1r1	T	A	6: 55,479,197	M190K	probably damaging	Het
Ankrd2	T	A	19: 42,044,919	L300Q		Het
Ankrd27	A	T	7: 35,591,869	Q30L	possibly damaging	Het
Atp8b5	T	A	4: 43,305,798	I114K	probably damaging	Het
Atrn	A	T	2: 130,944,889	I205F	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Boc	C	T	16: 44,491,329	R677H		Het
D3Ertd254e	T	A	3: 36,165,704	C625*	probably null	Het
Dpysl3	G	T	18: 43,329,857	T485K	probably damaging	Het
Esyt3	T	C	9: 99,311,985	D867G	possibly damaging	Het
Fam178b	G	A	1: 36,564,436	T478I	probably damaging	Het
Fam26f	A	G	10: 34,127,647	F88S	probably benign	Het
Foxd2	G	T	4: 114,907,653	T390K	possibly damaging	Het
Furin	A	G	7: 80,390,897	V731A	probably benign	Het
Gm6583	T	A	5: 112,355,073	E255V	probably benign	Het
Grin2a	T	A	16: 9,653,602	I601F	possibly damaging	Het
Hat1	G	A	2: 71,420,615	R169Q	possibly damaging	Het
Ighe	G	C	12: 113,273,231	Q6E		Het
Ighv8-2	T	C	12: 114,462,559	I31V	probably benign	Het
Klk1	A	G	7: 44,228,680	D120G	probably damaging	Het
Lamp5	A	T	2: 136,069,078	I244F	probably damaging	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mfsd4b1	T	C	10: 40,002,869	E344G	probably damaging	Het
Mns1	A	G	9: 72,439,274	K13R	probably benign	Het
Mrpl43	C	T	19: 45,005,907	S91N	probably benign	Het
Mtbp	T	C	15: 55,617,636	S706P	probably benign	Het
Nelfb	A	T	2: 25,205,133	V348D	probably damaging	Het
Olfr1049	G	A	2: 86,255,084	S203L	probably benign	Het
Olfr281	T	C	15: 98,456,832	I174T	possibly damaging	Het
Olfr355	T	A	2: 36,927,404	K237*	probably null	Het
Olfr497	A	T	7: 108,422,717	I49F	probably benign	Het
Olfr835	C	T	9: 19,035,945	A274V	possibly damaging	Het
Pde6c	T	C	19: 38,151,561	I324T	possibly damaging	Het
Phlpp2	T	A	8: 109,934,023	L770*	probably null	Het
Pik3c2b	T	A	1: 133,091,600	F1029I	possibly damaging	Het
Rfx2	A	T	17: 56,780,890	S500R	probably benign	Het
Sarm1	T	C	11: 78,474,917	M761V	probably benign	Het
Serpina1a	A	G	12: 103,855,881	L264P	possibly damaging	Het
Slc37a1	G	T	17: 31,337,991	G377V	probably damaging	Het
Slc38a4	T	A	15: 97,008,497	M364L	probably damaging	Het
Slc7a15	A	G	12: 8,530,280	F384S	probably benign	Het
Smyd4	T	C	11: 75,390,799	V366A	probably benign	Het
Spata31d1b	T	A	13: 59,718,341	V1101D	possibly damaging	Het
Stab2	C	A	10: 86,922,133	M1090I	probably benign	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tgds	A	T	14: 118,130,637	Y41*	probably null	Het
Tle4	G	T	19: 14,517,940	H142N	probably benign	Het
Tlx2	T	C	6: 83,069,293		probably null	Het
Tmem151a	C	G	19: 5,081,841	A446P	probably damaging	Het
Tmem205	A	T	9: 21,921,200	D138E	probably damaging	Het
Tmem57	A	T	4: 134,830,682	Y173*	probably null	Het
Tmprss9	A	G	10: 80,898,208	K1009E	unknown	Het
Tnk2	T	A	16: 32,680,057	C729*	probably null	Het
Trim46	T	A	3: 89,235,092	D696V	probably damaging	Het
Tuba3b	G	A	6: 145,618,756	R84Q	probably benign	Het
Unc119b	C	T	5: 115,125,462	D228N	probably damaging	Het
Usp17la	A	G	7: 104,861,657	T490A	probably benign	Het
Zfp687	C	T	3: 95,012,457	M1I	probably null	Het
Zfp729a	T	C	13: 67,620,509	T534A	possibly damaging	Het
Zfp985	A	T	4: 147,583,590	H305L	probably benign	Het
Zscan10	C	T	17: 23,609,356	Q291*	probably null	Het

Other mutations in Kmt2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Kmt2e	APN	5	23492358	missense	probably damaging	0.99
IGL01330:Kmt2e	APN	5	23497948	missense	possibly damaging	0.95
IGL01457:Kmt2e	APN	5	23502019	missense	possibly damaging	0.62
IGL01691:Kmt2e	APN	5	23497091	missense	probably benign
IGL02274:Kmt2e	APN	5	23500760	missense	probably benign	0.00
IGL02934:Kmt2e	APN	5	23497884	missense	probably damaging	0.97
IGL02964:Kmt2e	APN	5	23467100	splice site	probably benign
IGL03011:Kmt2e	APN	5	23497542	missense	probably damaging	1.00
IGL03291:Kmt2e	APN	5	23499291	missense	probably damaging	1.00
R0035:Kmt2e	UTSW	5	23485621	splice site	probably benign
R0446:Kmt2e	UTSW	5	23497534	splice site	probably null
R0498:Kmt2e	UTSW	5	23478972	nonsense	probably null
R0699:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0701:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0761:Kmt2e	UTSW	5	23503034	nonsense	probably null
R1110:Kmt2e	UTSW	5	23502655	missense	probably damaging	1.00
R1295:Kmt2e	UTSW	5	23502404	missense	probably damaging	0.99
R1432:Kmt2e	UTSW	5	23450321	missense	probably benign	0.39
R1495:Kmt2e	UTSW	5	23499327	missense	possibly damaging	0.83
R1505:Kmt2e	UTSW	5	23500535	missense	probably null	0.01
R1623:Kmt2e	UTSW	5	23482502	missense	probably damaging	1.00
R1675:Kmt2e	UTSW	5	23482453	nonsense	probably null
R1691:Kmt2e	UTSW	5	23464849	missense	probably damaging	1.00
R1778:Kmt2e	UTSW	5	23492364	missense	probably damaging	1.00
R1820:Kmt2e	UTSW	5	23473547	missense	probably damaging	1.00
R1846:Kmt2e	UTSW	5	23499486	intron	probably benign
R1912:Kmt2e	UTSW	5	23492395	missense	probably benign	0.07
R2070:Kmt2e	UTSW	5	23501995	missense	probably benign
R2195:Kmt2e	UTSW	5	23502196	splice site	probably null
R2571:Kmt2e	UTSW	5	23501887	missense	probably benign	0.08
R3901:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3902:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3905:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3906:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3909:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3956:Kmt2e	UTSW	5	23496025	missense	probably benign	0.00
R4242:Kmt2e	UTSW	5	23502822	unclassified	probably benign
R4299:Kmt2e	UTSW	5	23464914	missense	probably damaging	1.00
R4448:Kmt2e	UTSW	5	23464790	missense	possibly damaging	0.80
R4528:Kmt2e	UTSW	5	23473558	missense	possibly damaging	0.69
R4574:Kmt2e	UTSW	5	23492407	missense	possibly damaging	0.60
R4719:Kmt2e	UTSW	5	23492315	missense	probably damaging	1.00
R4754:Kmt2e	UTSW	5	23482441	missense	possibly damaging	0.88
R4787:Kmt2e	UTSW	5	23463083	missense	possibly damaging	0.65
R4812:Kmt2e	UTSW	5	23502587	missense	possibly damaging	0.86
R4853:Kmt2e	UTSW	5	23502341	missense	probably damaging	1.00
R5138:Kmt2e	UTSW	5	23502695	missense	probably damaging	0.99
R5306:Kmt2e	UTSW	5	23499333	missense	probably damaging	0.98
R5659:Kmt2e	UTSW	5	23497807	missense	probably damaging	0.99
R5907:Kmt2e	UTSW	5	23464706	missense	probably damaging	1.00
R5920:Kmt2e	UTSW	5	23499442	missense	possibly damaging	0.50
R6280:Kmt2e	UTSW	5	23499516	missense	possibly damaging	0.48
R6353:Kmt2e	UTSW	5	23493245	missense	probably damaging	1.00
R6375:Kmt2e	UTSW	5	23499519	missense	probably benign
R6553:Kmt2e	UTSW	5	23463026	missense	probably damaging	0.99
R6572:Kmt2e	UTSW	5	23497581	missense	possibly damaging	0.66
R6678:Kmt2e	UTSW	5	23499295	missense	possibly damaging	0.54
R6791:Kmt2e	UTSW	5	23499476	intron	probably benign
R6792:Kmt2e	UTSW	5	23499476	intron	probably benign
R6794:Kmt2e	UTSW	5	23499476	intron	probably benign
R6797:Kmt2e	UTSW	5	23482507	missense	possibly damaging	0.82
R6947:Kmt2e	UTSW	5	23497545	missense	probably damaging	1.00
R7023:Kmt2e	UTSW	5	23500487	missense	possibly damaging	0.46
R7036:Kmt2e	UTSW	5	23478743	missense	probably null	1.00
R7173:Kmt2e	UTSW	5	23464857	missense	probably damaging	1.00
R7202:Kmt2e	UTSW	5	23492294	unclassified	probably benign
R7563:Kmt2e	UTSW	5	23500273	missense	probably damaging	1.00
R7571:Kmt2e	UTSW	5	23478587	missense	probably damaging	1.00
R7604:Kmt2e	UTSW	5	23501765	missense	not run
R7722:Kmt2e	UTSW	5	23497018	missense	probably benign	0.00
R7758:Kmt2e	UTSW	5	23496070	missense	possibly damaging	0.92
R7794:Kmt2e	UTSW	5	23464716	missense	probably damaging	1.00
R8137:Kmt2e	UTSW	5	23501954	missense	probably damaging	1.00
R8341:Kmt2e	UTSW	5	23499453	missense	probably damaging	0.98
R8383:Kmt2e	UTSW	5	23485541	missense	probably benign	0.08
R8400:Kmt2e	UTSW	5	23497092	missense	probably benign	0.17
R8546:Kmt2e	UTSW	5	23481244	missense	probably damaging	1.00
R8750:Kmt2e	UTSW	5	23493217	missense	probably benign
R8786:Kmt2e	UTSW	5	23464866	missense	probably damaging	1.00
R9211:Kmt2e	UTSW	5	23464772	missense	possibly damaging	0.83
R9660:Kmt2e	UTSW	5	23478619	missense	probably damaging	1.00
RF026:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF028:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF040:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF042:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
Z1177:Kmt2e	UTSW	5	23481208	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AATTTAACTGAGCTGGGCCTG -3'
(R):5'- CCAGAAACATGCCTCTAGTGTC -3'

Sequencing Primer
(F):5'- GCCTGCAAGAAATAAAGACTATTGG -3'
(R):5'- AGTGTCATCCTGCTGAATCAG -3'

Posted On

2022-11-14