Incidental Mutation 'R9786:Olfr835'
ID 734338
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor 835
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R9786 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19032735-19037670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19035945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 274 (A274V)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect possibly damaging
Transcript: ENSMUST00000059315
AA Change: A274V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: A274V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213018
AA Change: A274V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,684 D441N possibly damaging Het
A4gnt T A 9: 99,620,483 M232K possibly damaging Het
Abcc1 T C 16: 14,405,063 S243P probably damaging Het
Acsl1 T C 8: 46,521,449 Y320H probably damaging Het
Adam11 A G 11: 102,762,264 S61G probably benign Het
Adamts1 G A 16: 85,795,414 T965I probably benign Het
Adcyap1r1 T A 6: 55,479,197 M190K probably damaging Het
Ankrd2 T A 19: 42,044,919 L300Q Het
Ankrd27 A T 7: 35,591,869 Q30L possibly damaging Het
Atp8b5 T A 4: 43,305,798 I114K probably damaging Het
Atrn A T 2: 130,944,889 I205F probably damaging Het
BC035947 A G 1: 78,511,924 probably benign Het
Boc C T 16: 44,491,329 R677H Het
D3Ertd254e T A 3: 36,165,704 C625* probably null Het
Dpysl3 G T 18: 43,329,857 T485K probably damaging Het
Esyt3 T C 9: 99,311,985 D867G possibly damaging Het
Fam178b G A 1: 36,564,436 T478I probably damaging Het
Fam26f A G 10: 34,127,647 F88S probably benign Het
Foxd2 G T 4: 114,907,653 T390K possibly damaging Het
Furin A G 7: 80,390,897 V731A probably benign Het
Gm6583 T A 5: 112,355,073 E255V probably benign Het
Grin2a T A 16: 9,653,602 I601F possibly damaging Het
Hat1 G A 2: 71,420,615 R169Q possibly damaging Het
Ighe G C 12: 113,273,231 Q6E Het
Ighv8-2 T C 12: 114,462,559 I31V probably benign Het
Klk1 A G 7: 44,228,680 D120G probably damaging Het
Kmt2e A G 5: 23,497,984 D1054G probably benign Het
Lamp5 A T 2: 136,069,078 I244F probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mfsd4b1 T C 10: 40,002,869 E344G probably damaging Het
Mns1 A G 9: 72,439,274 K13R probably benign Het
Mrpl43 C T 19: 45,005,907 S91N probably benign Het
Mtbp T C 15: 55,617,636 S706P probably benign Het
Nelfb A T 2: 25,205,133 V348D probably damaging Het
Olfr1049 G A 2: 86,255,084 S203L probably benign Het
Olfr281 T C 15: 98,456,832 I174T possibly damaging Het
Olfr355 T A 2: 36,927,404 K237* probably null Het
Olfr497 A T 7: 108,422,717 I49F probably benign Het
Pde6c T C 19: 38,151,561 I324T possibly damaging Het
Phlpp2 T A 8: 109,934,023 L770* probably null Het
Pik3c2b T A 1: 133,091,600 F1029I possibly damaging Het
Rfx2 A T 17: 56,780,890 S500R probably benign Het
Sarm1 T C 11: 78,474,917 M761V probably benign Het
Serpina1a A G 12: 103,855,881 L264P possibly damaging Het
Slc37a1 G T 17: 31,337,991 G377V probably damaging Het
Slc38a4 T A 15: 97,008,497 M364L probably damaging Het
Slc7a15 A G 12: 8,530,280 F384S probably benign Het
Smyd4 T C 11: 75,390,799 V366A probably benign Het
Spata31d1b T A 13: 59,718,341 V1101D possibly damaging Het
Stab2 C A 10: 86,922,133 M1090I probably benign Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tgds A T 14: 118,130,637 Y41* probably null Het
Tle4 G T 19: 14,517,940 H142N probably benign Het
Tlx2 T C 6: 83,069,293 probably null Het
Tmem151a C G 19: 5,081,841 A446P probably damaging Het
Tmem205 A T 9: 21,921,200 D138E probably damaging Het
Tmem57 A T 4: 134,830,682 Y173* probably null Het
Tmprss9 A G 10: 80,898,208 K1009E unknown Het
Tnk2 T A 16: 32,680,057 C729* probably null Het
Trim46 T A 3: 89,235,092 D696V probably damaging Het
Tuba3b G A 6: 145,618,756 R84Q probably benign Het
Unc119b C T 5: 115,125,462 D228N probably damaging Het
Usp17la A G 7: 104,861,657 T490A probably benign Het
Zfp687 C T 3: 95,012,457 M1I probably null Het
Zfp729a T C 13: 67,620,509 T534A possibly damaging Het
Zfp985 A T 4: 147,583,590 H305L probably benign Het
Zscan10 C T 17: 23,609,356 Q291* probably null Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
R8736:Olfr835 UTSW 9 19035478 missense probably damaging 1.00
R8868:Olfr835 UTSW 9 19035482 missense probably damaging 1.00
R8909:Olfr835 UTSW 9 19035592 missense probably benign 0.08
R9116:Olfr835 UTSW 9 19035477 missense probably damaging 1.00
R9479:Olfr835 UTSW 9 19035434 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATATTTGGTGGCATCCCAATCTC -3'
(R):5'- TCATAGGAAACCCTGCTTTCAG -3'

Sequencing Primer
(F):5'- GCATCCCAATCTCTGGTATTATTTTC -3'
(R):5'- AGGAAACCCTGCTTTCAGTATATTCC -3'
Posted On 2022-11-14